RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA03G413650
Reference: TK1151 Chr: Chr03 Coordinates: 102868261-102873246 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3494 bp · TkA03G413650|TK1151|cDNA

CAAGAGATGAGAAGGCACCGATGGCATTGCGTGCGCCATTGGTTGACCATTAAACCTCTTCTGTCCGTCTGATTTAAAGCAAGCAACCGATCTCATGATCTCATCTCTTTTATTTGGCATCTTGCTATGAATCACAATGGAAAGGAACCGACCCTTTGACCACGGTGGCGTTAATTTTTAACGGCACACAAAGCAGCCTACCATGTTACGCAATCATATATAACAATCACGAAAAGAAAGAAATCATTTACCAAACCCCC...

CDS

Download CDS FASTA

2835 bp · TkA03G413650|TK1151|CDS

ATGGAGGTCTCATCGTCATCATGTTCCTCCCCACTTTCGATTCATCGACTCGATTTCGCCCCACCTGTTTTGATCCGACCCATGTCGCGTTTCTCCTCCAAACCCGTTACCCGATTCACCCCTTCCACCACCTGTAACACTTCCTCTTCTTATGCATCTTCTTCTTCTGCTTCGTCGTCTTATTTTGGAGTCTCACTCTCGCACAAGCCCTTGAAATCGAAGAACAATAGCACCCTTTCTCGAAAAAGGCGTGGGTCGTT...

Protein

Download Protein FASTA

944 aa · TkA03G413650|TK1151|PROTEIN

MEVSSSSCSSPLSIHRLDFAPPVLIRPMSRFSSKPVTRFTPSTTCNTSSSYASSSSASSSYFGVSLSHKPLKSKNNSTLSRKRRGSFYIVAGVFERFTERAIKAVMFSQREAKALGKDMVFTQHLLLGLIAEDRSPGGFLESGITIDDAREAVRSIWDDEEPDQKEQVTTTSATDVSFSNSTKRVFEAAVEYSRTMGYKFIAPEHIAIGLLTVDDGSAGRVLQKLGADLNQLADVAVSRLQGELAKDGREAPKMLKNSSF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA03G413650
TK1151 IDTkA03G413650
OH-1004 IDLXL04_009257
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.900
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA03G413650
LocationChr03:102868261-102873246 (-)
DescriptionSimilar to CLPD: Chaperone protein ClpD, chloroplastic
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g51070 Molecular chaperone that interact with a ClpP-like protease involved in degradation of denatured proteins in the chloroplast.
Insights into the Clp/HSP100 chaperone system from chloroplasts of Arabidopsis thaliana.2011 · DOI: 10.1074/jbc.m110.211946
Chloroplastic Hsp100 chaperones ClpC2 and ClpD interact in vitro with a transit peptide only when it is located at the N-terminus of a protein.2012 · DOI: 10.1186/1471-2229-12-57
Characterization of the accessory protein ClpT1 from Arabidopsis thaliana: oligomerization status and interaction with Hsp100 chaperones.2014 · DOI: 10.1186/s12870-014-0228-0

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0405000 Molecular chaperone that may interact with a ClpP-like protease involved in degradation of denatured proteins in the chloroplast. No verified direct reference in this release
Os02g0526400 Molecular chaperone that may function in heat stress response.
Genome-wide analysis of rice ClpB/HSP100, ClpC and ClpD genes.2010 · DOI: 10.1186/1471-2164-11-95
Constitutive over-expression of rice ClpD1 protein enhances tolerance to salt and desiccation stresses in transgenic Arabidopsis plants.2016 · DOI: 10.1016/j.plantsci.2016.06.004
Os12g0230100 Molecular chaperone that may interact with a ClpP-like protease involved in degradation of denatured proteins in the chloroplast. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_009257 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0034605 cellular response to heat Biological Process
GO:0045037 protein import into chloroplast stroma Biological Process
GO:0065003 protein-containing complex assembly Biological Process
GO:1901002 positive regulation of response to salt stress Biological Process
GO:1902584 positive regulation of response to water deprivation Biological Process
GO:0009507 chloroplast Cellular Component
GO:0009536 plastid Cellular Component
GO:0009570 chloroplast stroma Cellular Component
GO:0009941 chloroplast envelope Cellular Component
GO:0032991 protein-containing complex Cellular Component
GO:0005524 ATP binding Molecular Function
GO:0016887 ATP hydrolysis activity Molecular Function
KEGG gene cross-reference
ath:AT5G51070
dosa:Os02g0526400
dosa:Os04g0405000
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.948
Rank 1 · TkA03G413650 · TK1151
Mitochondrion0.066
Rank 2 · TkA03G413650 · TK1151
Cytoplasm0.028
Rank 3 · TkA03G413650 · TK1151
Nucleus0.026
Rank 4 · TkA03G413650 · TK1151
Peroxisome0.020
Rank 5 · TkA03G413650 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02861Clp_N96-224 aa
PF02861Clp_N178-238 aa
PF00308Bac_DnaA292-342 aa
PF13191AAA_16296-345 aa
PF00158Sigma54_activat297-398 aa
PF20030bpMoxR297-352 aa
PF25201nSTAND6298-336 aa
PF01637ATPase_2299-338 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA03G413650PF02861Clp_N962245.4e-2795.2
TkA03G413650PF02861Clp_N1782385.4e-2795.2
TkA03G413650PF00308Bac_DnaA2923420.0007120.5
TkA03G413650PF13191AAA_162963451e-0836.6
TkA03G413650PF00158Sigma54_activat2973987e-0729.8
TkA03G413650PF20030bpMoxR2973520.008515.9
TkA03G413650PF25201nSTAND62983360.0713.9
TkA03G413650PF01637ATPase_22993380.0002221.8
TkA03G413650PF02367TsaE3003490.000720.3
TkA03G413650PF23569NBD_SMAX13003920.004717.5
TkA03G413650PF00931NB-ARC3003330.1912.0
TkA03G413650PF13604AAA_303063370.2112.0
TkA03G413650PF01078Mg_chelatase3103560.0007919.6
TkA03G413650PF01695IstB_IS213133400.0002321.5
TkA03G413650PF04851ResIII3133420.03414.8
TkA03G413650PF13401AAA_223143981.4e-0939.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
P42762Arabidopsis thalianasp|P42762|CLPD_ARATH Chaperone protein ClpD, chloroplastic70.500%Swiss-ProtHigh
Q7XL03Oryza sativa subsp. japonicasp|Q7XL03|CLPD2_ORYSJ Chaperone protein ClpD2, chloroplastic65.400%Swiss-ProtHigh
Q6H795Oryza sativa subsp. japonicasp|Q6H795|CLPD1_ORYSJ Chaperone protein ClpD1, chloroplastic66.400%Swiss-ProtHigh
Q2QVG9Oryza sativa subsp. japonicasp|Q2QVG9|CLPC2_ORYSJ Chaperone protein ClpC2, chloroplastic47.800%Swiss-ProtMedium

JBrowse

View in Genome Browser