LXL04_009257 | RubberDandelionOmics

Gene overview

LXL04_009257

Reference: OH-1004 Chr: Chr02 Coordinates: 121443075-121447372 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2835 bp · LXL04_009257|LXL04_009257|OH1004|cDNA

ATGGAGGTCTCATCGTCATCATGTTCCTCCCCACTTTCGATTCATCGACTCGATTTCGCCCCACCTGTTTTGATCCGACCCATGTCGCGTTTCTCCTCCAAACCCGTTACCCGATTCACCCCTTCCACCACCTGTAACACTTCCTCTTCTTAtgcatcttcttcttctgcttcgTCGTCTTATTTTGGAGTCTCACTCTCGCACAAGCCCTTGAAATCGAAGAACAATAGCACCCTTTCTCGAAAAAGGCGTGGGTCGTT...

CDS

Download CDS FASTA

2835 bp · LXL04_009257|LXL04_009257|OH1004|CDS

ATGGAGGTCTCATCGTCATCATGTTCCTCCCCACTTTCGATTCATCGACTCGATTTCGCCCCACCTGTTTTGATCCGACCCATGTCGCGTTTCTCCTCCAAACCCGTTACCCGATTCACCCCTTCCACCACCTGTAACACTTCCTCTTCTTATGCATCTTCTTCTTCTGCTTCGTCGTCTTATTTTGGAGTCTCACTCTCGCACAAGCCCTTGAAATCGAAGAACAATAGCACCCTTTCTCGAAAAAGGCGTGGGTCGTT...

Protein

Download Protein FASTA

944 aa · LXL04_009257|LXL04_009257|OH1004|PROTEIN

MEVSSSSCSSPLSIHRLDFAPPVLIRPMSRFSSKPVTRFTPSTTCNTSSSYASSSSASSSYFGVSLSHKPLKSKNNSTLSRKRRGSFYIVAGVFERFTERAIKAVMFSQREAKALGKDMVFTQHLLLGLIAEDRSPGGFLESGITIDDAREAVRSIWDDEEPDQKEQVTTTSATDVSFSNSTKRVFEAAVEYSRTMGYKFIAPEHIAIGLLTVDDGSAGRVLQKLGADLNQLADVAVSRLQGELAKDGREPPKMLKNSSF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_009257`
TK1151 ID	TkA03G413650
OH-1004 ID	LXL04_009257
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_009257

Location Chr02:121443075-121447372 (-)

Description Similar to CLPD: Chaperone protein ClpD, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51070`	Molecular chaperone that interact with a ClpP-like protease involved in degradation of denatured proteins in the chloroplast.	Insights into the Clp/HSP100 chaperone system from chloroplasts of Arabidopsis thaliana.2011 · DOI: 10.1074/jbc.m110.211946 Chloroplastic Hsp100 chaperones ClpC2 and ClpD interact in vitro with a transit peptide only when it is located at the N-terminus of a protein.2012 · DOI: 10.1186/1471-2229-12-57 Characterization of the accessory protein ClpT1 from Arabidopsis thaliana: oligomerization status and interaction with Hsp100 chaperones.2014 · DOI: 10.1186/s12870-014-0228-0

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0405000`	Molecular chaperone that may interact with a ClpP-like protease involved in degradation of denatured proteins in the chloroplast.	No verified direct reference in this release
`Os02g0526400`	Molecular chaperone that may function in heat stress response.	Genome-wide analysis of rice ClpB/HSP100, ClpC and ClpD genes.2010 · DOI: 10.1186/1471-2164-11-95 Constitutive over-expression of rice ClpD1 protein enhances tolerance to salt and desiccation stresses in transgenic Arabidopsis plants.2016 · DOI: 10.1016/j.plantsci.2016.06.004

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_009257 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0034605 cellular response to heat Biological Process

GO:0045037 protein import into chloroplast stroma Biological Process

GO:0065003 protein-containing complex assembly Biological Process

GO:1901002 positive regulation of response to salt stress Biological Process

GO:1902584 positive regulation of response to water deprivation Biological Process

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0009941 chloroplast envelope Cellular Component

GO:0032991 protein-containing complex Cellular Component

GO:0005524 ATP binding Molecular Function

GO:0016887 ATP hydrolysis activity Molecular Function

KEGG gene cross-reference

ath:AT5G51070

dosa:Os02g0526400

dosa:Os04g0405000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.949

Rank 1 · LXL04_009257 · OH-1004

Mitochondrion0.065

Rank 2 · LXL04_009257 · OH-1004

Cytoplasm0.028

Rank 3 · LXL04_009257 · OH-1004

Nucleus0.026

Rank 4 · LXL04_009257 · OH-1004

Peroxisome0.020

Rank 5 · LXL04_009257 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02861.26Clp_N96-224 aa

PF02861.26Clp_N197-237 aa

PF13191.13AAA_16296-345 aa

PF00004.36AAA319-426 aa

PF17871.8AAA_lid_9463-558 aa

PF07724.21AAA_2655-831 aa

PF00158.33Sigma54_activat658-778 aa

PF00004.36AAA660-778 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_009257	`PF02861.26`	Clp_N	96	224	3.9e-23	82.7
LXL04_009257	`PF02861.26`	Clp_N	197	237	3.9e-23	82.7
LXL04_009257	`PF13191.13`	AAA_16	296	345	1.1e-08	36.6
LXL04_009257	`PF00004.36`	AAA	319	426	2e-18	67.8
LXL04_009257	`PF17871.8`	AAA_lid_9	463	558	1.2e-28	99.8
LXL04_009257	`PF07724.21`	AAA_2	655	831	2.9e-66	223.3
LXL04_009257	`PF00158.33`	Sigma54_activat	658	778	6.9e-07	29.8
LXL04_009257	`PF00004.36`	AAA	660	778	2e-18	67.8
LXL04_009257	`PF07728.21`	AAA_5	660	781	8.4e-18	65.4
LXL04_009257	`PF13401.13`	AAA_22	660	755	1.4e-09	39.0
LXL04_009257	`PF10431.16`	ClpB_D2-small	837	916	4e-22	78.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P42762`	Arabidopsis thaliana	Chaperone protein ClpD, chloroplastic	70.354%	Swiss-Prot	strong database homology
`Q7XL03`	Oryza sativa subsp. japonica	Chaperone protein ClpD2, chloroplastic	66.135%	Swiss-Prot	strong database homology
`Q6H795`	Oryza sativa subsp. japonica	Chaperone protein ClpD1, chloroplastic	67.738%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card