TkAUNG094310 | RubberDandelionOmics

Gene overview

TkAUNG094310

Reference: TK1151 Chr: ChrUn Coordinates: 26666355-26669443 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1956 bp · TkAUNG094310|TK1151|cDNA

ATTGATAGAAGTATAAGAATTAATTGTTGTAAACTACAAATTATTAATGGTCGAAATTAATGATTTAATGAAAATGTTCTTGCCTTATTGGAAGACCGTTTTCTTGTGAAAGGGTAGAAAGGTAATACCAGACGTTTCTTCTAAACTTCTCTACAAAGCTAAACCCCATGTCGATGATGATGCTCATATGCCTATAAAACCAAAACCCAAATCCAAACATACTTCCATTTATACACACCACTTCCGTTAAATCTTCCATC...

CDS

Download CDS FASTA

1428 bp · TkAUNG094310|TK1151|CDS

ATGGCGTCGACGATAGATCGATCGGAGATAGCTTTCTTTGACCTGGAAACAACTGTTCCGATGCGACAGGGTCAGGGGTTTGCGATTTTGGAATTCGGGTCGATACTCGTTTGCCCTAAGAAGCTCGTTGAGCTCCAAAGCTACGAGACGTTGGTAAGACCACATGATCTCTCACTCATCTCCACTTTATCCGTTCGCGCCAACGGCATCACCGCCGACGCCGTTGCTTCCGCCCCGAGCTTCTCTGACATTGCCGATAA...

Protein

Download Protein FASTA

475 aa · TkAUNG094310|TK1151|PROTEIN

MASTIDRSEIAFFDLETTVPMRQGQGFAILEFGSILVCPKKLVELQSYETLVRPHDLSLISTLSVRANGITADAVASAPSFSDIADKVYDILHGRIWAGHNIIRFDCVRLREAFAQINRPPPEPKGTIDSLALLTQRFGRRAGNMKMATLADYFGLGKQSHRSLDDVRMNLEVLKYCATVLFLESSLPDIFTENSWVSPNTTTRNRNGTAVTTSPPSSSTNTRNPNPPQNHPIISLAASGAGQPDPFDLGPLVDKIDQPN...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkAUNG094310`
TK1151 ID	TkAUNG094310
OH-1004 ID	LXL04_029232
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	63.900
Protein coverage (%)	TK1151 41.895 / OH-1004 61.280 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkAUNG094310

Location ChrUn:26666355-26669443 (+)

Description Similar to NEN4: Protein NEN4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g74390`	Probable exonuclease that may be involved in enuclation of sieve elements.	No verified direct reference in this release
`At5g07710`	Probable exonuclease involved in enuclation of sieve elements.	No verified direct reference in this release
`At5g61390`	Probable exonuclease involved in enuclation of sieve elements.	No verified direct reference in this release
`At4g39810`	Probable exonuclease required for enuclation of sieve elements.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029232 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006261 DNA-templated DNA replication Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003887 DNA-directed DNA polymerase activity Molecular Function

GO:0008408 3'-5' exonuclease activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G74390

ath:AT4G39810

ath:AT5G07710

ath:AT5G61390

tte:TTE1398

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.764

Rank 1 · TkAUNG094310 · TK1151

Cytoplasm0.248

Rank 2 · TkAUNG094310 · TK1151

Cell membrane0.049

Rank 3 · TkAUNG094310 · TK1151

Plastid0.042

Rank 4 · TkAUNG094310 · TK1151

Endoplasmic reticulum0.042

Rank 5 · TkAUNG094310 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00929RNase_T12-174 aa

PF17715DUF5560180-243 aa

PF00929RNase_T265-290 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkAUNG094310	`PF00929`	RNase_T	12	174	1.4e-26	94.7
TkAUNG094310	`PF17715`	DUF5560	180	243	0.14	12.3
TkAUNG094310	`PF00929`	RNase_T	265	290	1.4e-26	94.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9CA74`	Arabidopsis thaliana	sp\|Q9CA74\|NEN3_ARATH Protein NEN3	53.100%	Swiss-Prot	High
`Q9FLR0`	Arabidopsis thaliana	sp\|Q9FLR0\|NEN1_ARATH Protein NEN1	55.200%	Swiss-Prot	High
`Q0V842`	Arabidopsis thaliana	sp\|Q0V842\|NEN2_ARATH Protein NEN2	52.700%	Swiss-Prot	High
`F4JJ23`	Arabidopsis thaliana	sp\|F4JJ23\|NEN4_ARATH Protein NEN4	66.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card