LXL04_029232 | RubberDandelionOmics

Gene overview

LXL04_029232

Reference: OH-1004 Chr: Chr06 Coordinates: 84414369-84415726 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

987 bp · LXL04_029232|LXL04_029232|OH1004|cDNA

ATGCAAGAAATGGCGAACGAGATAGTCTTCTTTGATTTGGAAACAAACGTGCCAAGAAACCCCGGCCAAAAATTCTGGGTGCTTGAGTTTGGAGCGATGGTGGTTTGCCCAAGAAAGCTTGTCGAGATCGAGAGTTACTCCACATTAATTCGACCTGGAGACTTGTCGGTTGTGGGGGTGAATCCAGCGAGGTGCCATGGGATCTCACGAGGAACGGTTTTGTCAGCTCCCACTTTCGAACAAGTTGCCGATAAGATATT...

CDS

Download CDS FASTA

987 bp · LXL04_029232|LXL04_029232|OH1004|CDS

ATGCAAGAAATGGCGAACGAGATAGTCTTCTTTGATTTGGAAACAAACGTGCCAAGAAACCCCGGCCAAAAATTCTGGGTGCTTGAGTTTGGAGCGATGGTGGTTTGCCCAAGAAAGCTTGTCGAGATCGAGAGTTACTCCACATTAATTCGACCTGGAGACTTGTCGGTTGTGGGGGTGAATCCAGCGAGGTGCCATGGGATCTCACGAGGAACGGTTTTGTCAGCTCCCACTTTCGAACAAGTTGCCGATAAGATATT...

Protein

Download Protein FASTA

328 aa · LXL04_029232|LXL04_029232|OH1004|PROTEIN

MQEMANEIVFFDLETNVPRNPGQKFWVLEFGAMVVCPRKLVEIESYSTLIRPGDLSVVGVNPARCHGISRGTVLSAPTFEQVADKIFEILNGRIWAGHNIQRFDCVRIKAAFEEIGRPAPEPVALIDSLWVLSDKFGKRAGNMKMASLASYFGLGEQKHRSLDDARMNLEVLKHCATVLFLESSLPGILENQWQHNSSPNVTTRSRSTDLMEPSVSTSINKPWSQKESISSSTINNGWNQKESSISRTMNKGWNQESPPT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_029232`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_029232

Location Chr06:84414369-84415726 (-)

Description Similar to NEN4: Protein NEN4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g39810`	Probable exonuclease required for enuclation of sieve elements.	No verified direct reference in this release
`At1g74390`	Probable exonuclease that may be involved in enuclation of sieve elements.	No verified direct reference in this release
`At5g07710`	Probable exonuclease involved in enuclation of sieve elements.	No verified direct reference in this release
`At5g61390`	Probable exonuclease involved in enuclation of sieve elements.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029232 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006261 DNA-templated DNA replication Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0003676 nucleic acid binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003887 DNA-directed DNA polymerase activity Molecular Function

GO:0008408 3'-5' exonuclease activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT1G74390

ath:AT4G39810

ath:AT5G07710

ath:AT5G61390

tte:TTE1398

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.553

Rank 1 · LXL04_029232 · OH-1004

Cytoplasm0.392

Rank 2 · LXL04_029232 · OH-1004

Cell membrane0.089

Rank 3 · LXL04_029232 · OH-1004

Endoplasmic reticulum0.056

Rank 4 · LXL04_029232 · OH-1004

Mitochondrion0.052

Rank 5 · LXL04_029232 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00929.32RNase_T9-172 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_029232	`PF00929.32`	RNase_T	9	172	4.8e-27	96.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4JJ23`	Arabidopsis thaliana	Protein NEN4	69.417%	Swiss-Prot	moderate database homology
`Q9CA74`	Arabidopsis thaliana	Protein NEN3	64.532%	Swiss-Prot	moderate database homology
`Q9FLR0`	Arabidopsis thaliana	Protein NEN1	56.306%	Swiss-Prot	moderate database homology
`Q0V842`	Arabidopsis thaliana	Protein NEN2	56.311%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card