Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1561 bp · TkAUNG094030|TK1151|cDNA
ATAAGTACTACGATTGAAGTTACGGGTAGAAGTAAATCAATAAAACCTCTCTTCGTCATACATAATCCGCCCTCCGTGGCCTTTTCTTCCACTGAAATGTTGGTGCAGACTCTCCTATGGAAATTCCCATTTTCCTATAACAAACGCACACATCCTACGCTTCTCTTCACATCCCCGTCCATTAGCTCTAGCACACTACCTTTGAATAACTCAATTCGCAGTCAAAGAACTTCAGTTTCCCCAATCACAACTTCTTCATC...
966 bp · TkAUNG094030|TK1151|CDS
ATAAGTACTACGATTGAAGTTACGGGTAGAAGTAAATCAATAAAACCTCTCTTCGTCATACATAATCCGCCCTCCGTGGCCTTTTCTTCCACTGAAATGTTGGTGCAGACTCTCCTATGGAAATTCCCATTTTCCTATAACAAACGCACACATCCTACGCTTCTCTTCACATCCCCGTCCATTAGCTCTAGCACACTACCTTTGAATAACTCAATTCGCAGTCAAAGAACTTCAGTTTCCCCAATCACAACTTCTTCATC...
Protein
Download Protein FASTA321 aa · TkAUNG094030|TK1151|PROTEIN
ISTTIEVTGRSKSIKPLFVIHNPPSVAFSSTEMLVQTLLWKFPFSYNKRTHPTLLFTSPSISSSTLPLNNSIRSQRTSVSPITTSSSVSTTEEVGRFVSDQHLKLKNICEGHVPDHILRRIEELGYIMPTEIQRQALPVLFSGQDCILHAQTGSGKTLAYLLQIYSVINTQRSAVQALIVVPTRELGMQVAKVARMLAAQPDQPIEDKPCTIMALLDGGTLRRQKSWLKAEPPTIIVATLGSLCQLLEKQTIKLESMRVL...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkAUNG094030 |
|---|---|
| TK1151 ID | TkAUNG094030 |
| OH-1004 ID | LXL04_032295 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 33.700 |
| Protein coverage (%) | TK1151 59.190 / OH-1004 22.007Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkAUNG094030 | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Location | ChrUn:26586554-26590039 (+) | |||||||||||||||||||||
| Description | Similar to RH29: Putative DEAD-box ATP-dependent RNA helicase 29 | |||||||||||||||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
Rice
| |||||||||||||||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||||||||||||||
| GO annotations (OH1004 source) | GO:0006351 DNA-templated transcription Biological Process GO:0006364 rRNA processing Biological Process GO:0006396 RNA processing Biological Process GO:0009409 response to cold Biological Process GO:0016070 RNA metabolic process Biological Process GO:0030520 estrogen receptor signaling pathway Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005730 nucleolus Cellular Component GO:0005794 Golgi apparatus Cellular Component GO:0005829 cytosol Cellular Component GO:0016020 membrane Cellular Component | |||||||||||||||||||||
| KEGG gene cross-reference | ath:AT1G77030 dosa:Os08g0416100 hsa:79039 mmu:71990 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF00270DEAD130-302 aaPF13245AAA_19133-282 aaPF04851ResIII144-265 aaPF00176SNF2-rel_dom144-188 aaPF13401AAA_22146-283 aaPF26815Phage_RepB175-228 aaPF26815Phage_RepB255-301 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkAUNG094030 | PF00270 | DEAD | 130 | 302 | 2.2e-32 | 112.8 |
| TkAUNG094030 | PF13245 | AAA_19 | 133 | 282 | 0.0018 | 19.2 |
| TkAUNG094030 | PF04851 | ResIII | 144 | 265 | 1.1e-07 | 32.7 |
| TkAUNG094030 | PF00176 | SNF2-rel_dom | 144 | 188 | 0.082 | 12.7 |
| TkAUNG094030 | PF13401 | AAA_22 | 146 | 283 | 0.0013 | 19.7 |
| TkAUNG094030 | PF26815 | Phage_RepB | 175 | 228 | 0.076 | 13.4 |
| TkAUNG094030 | PF26815 | Phage_RepB | 255 | 301 | 0.076 | 13.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
| Protein | Organism | Description | Identity | Database | Confidence |
|---|---|---|---|---|---|
Q3E9C3 | Arabidopsis thaliana | sp|Q3E9C3|RH58_ARATH DEAD-box ATP-dependent RNA helicase 58, chloroplastic | 70.200% | Swiss-Prot | Medium |
Q8W4E1 | Arabidopsis thaliana | sp|Q8W4E1|RH47_ARATH DEAD-box ATP-dependent RNA helicase 47, mitochondrial | 32.300% | Swiss-Prot | Medium |
Q0JFN7 | Oryza sativa subsp. japonica | sp|Q0JFN7|RH58_ORYSJ DEAD-box ATP-dependent RNA helicase 58, chloroplastic | 69.200% | Swiss-Prot | Medium |
Q6H874 | Oryza sativa subsp. japonica | sp|Q6H874|RH47A_ORYSJ DEAD-box ATP-dependent RNA helicase 47A | 31.900% | Swiss-Prot | Medium |
Q10PV9 | Oryza sativa subsp. japonica | sp|Q10PV9|RH47B_ORYSJ DEAD-box ATP-dependent RNA helicase 47B | 31.400% | Swiss-Prot | Medium |