RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkAUNG044110
Reference: TK1151 Chr: ChrUn Coordinates: 12256788-12262709 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

4149 bp · TkAUNG044110|TK1151|cDNA

CGGAACGAGATAATTTCTCCCCATTTCTAACAACAACCCTTTCTTCCCTCCCACAACAAAATTAATCTTAGAAACCGAGTTTATAGAATATGATCACAAAGAGGAGAGAGAGTGTGTGTGTGAATAAAGAAATCGCCAAATTCAATTTCTCTGTTTTCATTACAGCCAGCTCTCCCTCATTCTTCATAATATTGTCGCTCTTTCATCCATGAACATGCTGCATTCCTTTCCCCATAGATGATAGCGTACAAAAAGACCCA...

CDS

Download CDS FASTA

3633 bp · TkAUNG044110|TK1151|CDS

ATGGCGGAGACCAAACCGGCGGATACCAAAACGGCGGAGACCAAATCGGCGGATACCAAAACGGCGGAGACGTTAGACACATTTTCGCTTTCTGTGGGGTCGATGGTTGAAGAAGTTCTTCAGGAGCAAGGCCCGAAATTGTGCGAGGCCAATGTGCCAGTCAAGCCTGATTCAAAAATCGCAAGAAAAAGAAATGATGCAACAAGATTTCTAAGAAAGTCGGTAGGTGTGGTGGCTGCAAAAGATTTACCAGCCGAGCC...

Protein

Download Protein FASTA

1210 aa · TkAUNG044110|TK1151|PROTEIN

MAETKPADTKTAETKSADTKTAETLDTFSLSVGSMVEEVLQEQGPKLCEANVPVKPDSKIARKRNDATRFLRKSVGVVAAKDLPAEPSENDFRLGLRSGIVFCKYMNKIEPGAISKIVEAPFDSVIIPDGEPLSSSQYFENITNFLSAINERGLPSFEASDLEQGGRIVKVVNCVLALKAYGEWKKAGANGTFKWGMKKPSSERKEKVHKALDMNKCVELWKDEVKEKSLQERVRDLLSNHKPRDVPIIVEIVLSKLTED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkAUNG044110
TK1151 IDTkAUNG044110
OH-1004 IDLXL04_001277
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)97.900
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkAUNG044110
LocationChrUn:12256788-12262709 (+)
DescriptionSimilar to KIN14F: Kinesin-like protein KIN-14F
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g27000 Microtubule-binding motor protein. No verified direct reference in this release
At2g47500 Kinesin-like protein KIN-14I. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os03g0301800 Kinesin-like protein KIN-14F. No verified direct reference in this release
Os11g0672400 Kinesin-like protein KIN-14P. No verified direct reference in this release
Os12g0547500 Minus end-directed motor protein that transports actin filaments along microtubules.
Dynamic bridges--a calponin-domain kinesin from rice links actin filaments and microtubules in both cycling and non-cycling cells.2009 · DOI: 10.1093/pcp/pcp094
A kinesin with calponin-homology domain is involved in premitotic nuclear migration.2010 · DOI: 10.1093/jxb/erq164
The non-processive rice kinesin-14 OsKCH1 transports actin filaments along microtubules with two distinct velocities.2015 · DOI: 10.1038/nplants.2015.111
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_001277 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0007017 microtubule-based process Biological Process
GO:0007018 microtubule-based movement Biological Process
GO:0007097 nuclear migration Biological Process
GO:0031534 minus-end directed microtubule sliding Biological Process
GO:0051647 nucleus localization Biological Process
GO:0005874 microtubule Cellular Component
GO:0015629 actin cytoskeleton Cellular Component
GO:0015630 microtubule cytoskeleton Cellular Component
GO:0003777 microtubule motor activity Molecular Function
GO:0003779 actin binding Molecular Function
GO:0005524 ATP binding Molecular Function
GO:0008017 microtubule binding Molecular Function
KEGG gene cross-reference
dosa:Os03g0301800
dosa:Os12g0547500
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.706
Rank 1 · TkAUNG044110 · TK1151
Cell membrane0.224
Rank 2 · TkAUNG044110 · TK1151
Nucleus0.180
Rank 3 · TkAUNG044110 · TK1151
Golgi apparatus0.048
Rank 4 · TkAUNG044110 · TK1151
Endoplasmic reticulum0.041
Rank 5 · TkAUNG044110 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00307CH88-182 aa
PF00225Kinesin295-341 aa
PF16796Microtub_bd305-340 aa
PF00225Kinesin499-537 aa
PF16796Microtub_bd533-577 aa
PF00225Kinesin654-654 aa
PF16796Microtub_bd678-678 aa
PF00307CH731-749 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkAUNG044110PF00307CH881823.6e-1143.9
TkAUNG044110PF00225Kinesin2953411.5e-105353.5
TkAUNG044110PF16796Microtub_bd3053402.3e-40138.8
TkAUNG044110PF00225Kinesin4995371.5e-105353.5
TkAUNG044110PF16796Microtub_bd5335772.3e-40138.8
TkAUNG044110PF00225Kinesin6546541.5e-105353.5
TkAUNG044110PF16796Microtub_bd6786782.3e-40138.8
TkAUNG044110PF00307CH7317493.6e-1143.9
TkAUNG044110PF16796Microtub_bd7839402.3e-40138.8
TkAUNG044110PF00225Kinesin82311191.5e-105353.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
O81635Arabidopsis thalianasp|O81635|KN14G_ARATH Kinesin-like protein KIN-14G35.300%Swiss-ProtMedium
F4IL57Arabidopsis thalianasp|F4IL57|KN14I_ARATH Kinesin-like protein KIN-14I35.100%Swiss-ProtMedium
Q10MN5Oryza sativa subsp. japonicasp|Q10MN5|KN14F_ORYSJ Kinesin-like protein KIN-14F34.900%Swiss-ProtMedium
B9G8P1Oryza sativa subsp. japonicasp|B9G8P1|KN14P_ORYSJ Kinesin-like protein KIN-14P35.000%Swiss-ProtMedium
Q0IMS9Oryza sativa subsp. japonicasp|Q0IMS9|KN14Q_ORYSJ Kinesin-like protein KIN-14Q35.100%Swiss-ProtMedium

JBrowse

View in Genome Browser