TkA08G434400 | RubberDandelionOmics

Gene overview

TkA08G434400

Reference: TK1151 Chr: Chr08 Coordinates: 110403166-110405637 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1066 bp · TkA08G434400|TK1151|cDNA

TTAAAAGAACGGTACGAATGAAATTTCCCAAAAGAAGAAAAAATATCATCGATATCAGATCAGATGAACCAGATGTTGCAAGAGCCCCATGGAAAGAGACCCAACAAGAAAAAAAAATGAAGCCTTCTTCCACATTACTATTCGCATTAAAACCCATTGCACTCCTCGCAATCACGTTCTCCATCACCATATTCACGATACTCCTGTCTTCTCCTTTTGAATCAATCAAGCCAATGGCGTCTCGAAGCTTCATCTTATGG...

CDS

Download CDS FASTA

861 bp · TkA08G434400|TK1151|CDS

ATGAAATTTCCCAAAAGAAGAAAAAATATCATCGATATCAGATCAGATGAACCAGATGTTGCAAGAGCCCCATGGAAAGAGACCCAACAAGAAAAAAAAATGAAGCCTTCTTCCACATTACTATTCGCATTAAAACCCATTGCACTCCTCGCAATCACGTTCTCCATCACCATATTCACGATACTCCTGTCTTCTCCTTTTGAATCAATCAAGCCAATGGCGTCTCGAAGCTTCATCTTATGGCTACACGGTCTTGGTGA...

Protein

Download Protein FASTA

286 aa · TkA08G434400|TK1151|PROTEIN

MKFPKRRKNIIDIRSDEPDVARAPWKETQQEKKMKPSSTLLFALKPIALLAITFSITIFTILLSSPFESIKPMASRSFILWLHGLGDSGPANEPIKSLFTSPQFANTRWSFPSAPSQPVTCNYGAVMPSWFDIHEIPITSSSPLDESSLLKAVRNVHSVIDKELAAGIDPKNVFICGFSQGGALTLSSVLLYPKTLGGGAVFSGWVPFNSTTIIDQITPEAKRTPILWSHGIADGTVMFEAGQAGPPFLQRLGINCEFKA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G434400`
TK1151 ID	TkA08G434400
OH-1004 ID	LXL04_015570
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	23.400
Protein coverage (%)	TK1151 75.874 / OH-1004 88.148 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G434400

Location Chr08:110403166-110405637 (+)

Description Similar to DDB_G0282005: Acyl-protein thioesterase 1 homolog 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g22300`	Carboxylesterase.	No verified direct reference in this release
`At4g22305`	Possesses carboxylesterase activity in vitro with a preference for short acyl chain substrates.	SOBER1 phospholipase activity suppresses phosphatidic acid accumulation and plant immunity in response to bacterial effector AvrBsT.2009 · DOI: 10.1073/pnas.0903859106

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0669500`	Possesses carboxylesterase activity in vitro.	No verified direct reference in this release
`Os04g0669700`	Probable inactive carboxylesterase Os04g0669700.	No verified direct reference in this release
`Os04g0669600`	Possesses carboxylesterase activity in vitro.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_015570 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002084 protein depalmitoylation Biological Process

GO:0006631 fatty acid metabolic process Biological Process

GO:0046464 acylglycerol catabolic process Biological Process

GO:1905344 prostaglandin catabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005795 Golgi stack Cellular Component

GO:0005829 cytosol Cellular Component

GO:0070062 extracellular exosome Cellular Component

GO:0004622 phosphatidylcholine lysophospholipase A1 activity Molecular Function

GO:0008474 palmitoyl-(protein) hydrolase activity Molecular Function

KEGG gene cross-reference

cnb:CNBF2260

ddi:DDB_G0282005

hsa:11313

mmu:26394

rno:83510

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.552

Rank 1 · TkA08G434400 · TK1151

Cytoplasm0.177

Rank 2 · TkA08G434400 · TK1151

Peroxisome0.102

Rank 3 · TkA08G434400 · TK1151

Nucleus0.088

Rank 4 · TkA08G434400 · TK1151

Mitochondrion0.086

Rank 5 · TkA08G434400 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02230Abhydrolase_276-281 aa

PF12697Abhydrolase_680-204 aa

PF12146Hydrolase_4151-204 aa

PF07859Abhydrolase_3155-192 aa

PF01738DLH167-272 aa

PF05448AXE1167-194 aa

PF00326Peptidase_S9168-190 aa

PF12146Hydrolase_4220-272 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G434400	`PF02230`	Abhydrolase_2	76	281	1.1e-46	160.1
TkA08G434400	`PF12697`	Abhydrolase_6	80	204	0.029	15.7
TkA08G434400	`PF12146`	Hydrolase_4	151	204	3.9e-07	30.4
TkA08G434400	`PF07859`	Abhydrolase_3	155	192	0.014	15.9
TkA08G434400	`PF01738`	DLH	167	272	4.5e-07	30.4
TkA08G434400	`PF05448`	AXE1	167	194	0.06	12.8
TkA08G434400	`PF00326`	Peptidase_S9	168	190	1.4e-05	25.4
TkA08G434400	`PF12146`	Hydrolase_4	220	272	3.9e-07	30.4
TkA08G434400	`PF00326`	Peptidase_S9	222	284	1.4e-05	25.4
TkA08G434400	`PF07859`	Abhydrolase_3	249	267	0.014	15.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8GYK2`	Arabidopsis thaliana	sp\|Q8GYK2\|SOBRL_ARATH Probable carboxylesterase SOBER1-like	74.800%	Swiss-Prot	High
`Q84WK4`	Arabidopsis thaliana	sp\|Q84WK4\|SOBR1_ARATH Carboxylesterase SOBER1	68.100%	Swiss-Prot	High
`Q0J969`	Oryza sativa subsp. japonica	sp\|Q0J969\|CAEH1_ORYSJ Probable carboxylesterase Os04g0669500	70.200%	Swiss-Prot	High
`Q7XR62`	Oryza sativa subsp. japonica	sp\|Q7XR62\|CAEH3_ORYSJ Probable inactive carboxylesterase Os04g0669700	52.300%	Swiss-Prot	High
`Q0J968`	Oryza sativa subsp. japonica	sp\|Q0J968\|CAEH2_ORYSJ Probable carboxylesterase Os04g0669600	52.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card