LXL04_015570 | RubberDandelionOmics

Gene overview

LXL04_015570

Reference: OH-1004 Chr: Chr03 Coordinates: 76167558-76176301 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

813 bp · LXL04_015570|LXL04_015570|OH1004|cDNA

ATGAGCTACAACAGATCAAACCTAGGTTCTGGTAGTAGGAATTTCGGAAGGAACACATTTGAGTTTGGAAGGACTTATGTTGTGAGGCCCAAAGGCACCCACCAAGCAACTATCGTTTGGTTACATGGCATAGGTGAAATGGGATCAAGTTGGTCCCAATTCTTGGAATCTCTGCCTCTTCCAAATATCAAGTGGATCTGCCCAACTGCCCCAACTCGTACGATAGCTTTATTTGGTGGAATACAGTCTACTGCATGGTT...

CDS

Download CDS FASTA

813 bp · LXL04_015570|LXL04_015570|OH1004|CDS

ATGAGCTACAACAGATCAAACCTAGGTTCTGGTAGTAGGAATTTCGGAAGGAACACATTTGAGTTTGGAAGGACTTATGTTGTGAGGCCCAAAGGCACCCACCAAGCAACTATCGTTTGGTTACATGGCATAGGTGAAATGGGATCAAGTTGGTCCCAATTCTTGGAATCTCTGCCTCTTCCAAATATCAAGTGGATCTGCCCAACTGCCCCAACTCGTACGATAGCTTTATTTGGTGGAATACAGTCTACTGCATGGTT...

Protein

Download Protein FASTA

270 aa · LXL04_015570|LXL04_015570|OH1004|PROTEIN

MSYNRSNLGSGSRNFGRNTFEFGRTYVVRPKGTHQATIVWLHGIGEMGSSWSQFLESLPLPNIKWICPTAPTRTIALFGGIQSTAWFNVEDMSDNATDDVEGLDASATHIANMLSNERDDIKLGVAGFSMGAAMALYCAACRVLGQYGNGNRYPINLSVAVSLSGWLPCSRMVRSRVHASQEATRRAALLPILLCHGQGICDTYIYAQLAMDDVVEYKHGEKSAQTLRSVGFQNLIFRTYNGLGHYTTPEEVNDVCCWLV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_015570`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_015570`
Location	Chr03:76167558-76176301 (+)
Description	Similar to DDB_G0282005: Acyl-protein thioesterase 1 homolog 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_015570` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0002084 protein depalmitoylation Biological Process GO:0006631 fatty acid metabolic process Biological Process GO:0046464 acylglycerol catabolic process Biological Process GO:1905344 prostaglandin catabolic process Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005795 Golgi stack Cellular Component GO:0005829 cytosol Cellular Component GO:0070062 extracellular exosome Cellular Component GO:0004622 phosphatidylcholine lysophospholipase A1 activity Molecular Function GO:0008474 palmitoyl-(protein) hydrolase activity Molecular Function
KEGG gene cross-reference	cnb:CNBF2260 ddi:DDB_G0282005 hsa:11313 mmu:26394 rno:83510 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.495

Rank 1 · LXL04_015570 · OH-1004

Nucleus0.446

Rank 2 · LXL04_015570 · OH-1004

Plastid0.118

Rank 3 · LXL04_015570 · OH-1004

Peroxisome0.057

Rank 4 · LXL04_015570 · OH-1004

Cell membrane0.055

Rank 5 · LXL04_015570 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02230.23Abhydrolase_226-256 aa

PF03959.20FSH180-198 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_015570	`PF02230.23`	Abhydrolase_2	26	256	1.4e-30	107.5
LXL04_015570	`PF03959.20`	FSH1	80	198	2.3e-06	28.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card