TkA08G257980 | RubberDandelionOmics

Gene overview

TkA08G257980

Reference: TK1151 Chr: Chr08 Coordinates: 67251307-67255394 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2452 bp · TkA08G257980|TK1151|cDNA

TTTTTTCGTACAAGAAATTTATTGCATCTACTGAACTTGGACTCGGTCTATTTCCAATCTCCAAAAAGGAAATAAAAGTTGTGTTTGAGAGAAACCGCTTTCATTCATTCATCTCACAAAGTCGCCATCACCAAGAAGAAAAAAAAAAAGACAATCCTCCTTCTTTTTCTCGCTGTTTTCAGGGGATAAGAGCGATCTGGGTCCCGATATACTCCCTTCTTTCGGTGTTCATGCTTTGGTGTTCATAAATCTTGTATTCT...

CDS

Download CDS FASTA

1578 bp · TkA08G257980|TK1151|CDS

ATGTCGTCTTCATCAACTTCAACATCGACTTCAACACAACCCACAAAACCCCCAATTTTGAAGAAACCAATCCTACCACCATCATCGAACCCGAAACCTAACTGGGTACTCAAGCAAAAAACCCCAATCCTTCAACAGTTGTACACAATCGGAAGAAAATTAGGACAAGGACAGTTCGGTACAACCCATCTATGCACAGAGAAATCCACAGGCATTCCTTACGCCTGCAAATCGATACCCAAGAAGAAACTCATATGCAG...

Protein

Download Protein FASTA

525 aa · TkA08G257980|TK1151|PROTEIN

MSSSSTSTSTSTQPTKPPILKKPILPPSSNPKPNWVLKQKTPILQQLYTIGRKLGQGQFGTTHLCTEKSTGIPYACKSIPKKKLICREDYEDVLKEIQIMHHLSEHTNVVRIKGTYEDALYVHIVMELCAGGELFDRIVQKGQYSEREAAKLIKTIVGVVEACHSLGVMHRDLKPENFLFSTTHEDATLKATDFGLSVFYKPGETFSDVVGSPYYVAPEVLRKHYGPESDVWSAGVILYILLSGVPPFWAETEMGIFRQI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G257980`
TK1151 ID	TkA08G257980
OH-1004 ID	LXL04_032800
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	63.900
Protein coverage (%)	TK1151 88.000 / OH-1004 78.974 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G257980

Location Chr08:67251307-67255394 (-)

Description Similar to CPK20: Calcium-dependent protein kinase 20

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g23580`	May play a role in signal transduction pathways that involve calcium as a second messenger.	Expression of three members of the calcium-dependent protein kinase gene family in Arabidopsis thaliana.1996 · DOI: 10.1007/bf00019557
`At4g09570`	May play a role in signal transduction pathways that involve calcium as a second messenger.	A novel yeast two-hybrid approach to identify CDPK substrates: characterization of the interaction between AtCPK11 and AtDi19, a nuclear zinc finger protein.2006 · DOI: 10.1016/j.febslet.2006.01.013 Two calcium-dependent protein kinases, CPK4 and CPK11, regulate abscisic acid signal transduction in Arabidopsis.2007 · DOI: 10.1105/tpc.107.050666

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0169800`	May play a role in signal transduction pathways that involve calcium as a second messenger.	No verified direct reference in this release
`Os04g0584600`	May play a role in signal transduction pathways that involve calcium as a second messenger (By similarity).	No verified direct reference in this release
`Os11g0171500`	May play a role in signal transduction pathways that involve calcium as a second messenger (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032800 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0035556 intracellular signal transduction Biological Process

GO:0043067 regulation of programmed cell death Biological Process

GO:0046777 protein autophosphorylation Biological Process

GO:1900055 regulation of leaf senescence Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005777 peroxisome Cellular Component

GO:0005778 peroxisomal membrane Cellular Component

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

KEGG gene cross-reference

ath:AT2G38910

ath:AT3G10660

ath:AT5G04870

dosa:Os03g0788500

dosa:Os03g0789000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.574

Rank 1 · TkA08G257980 · TK1151

Nucleus0.246

Rank 2 · TkA08G257980 · TK1151

Cell membrane0.238

Rank 3 · TkA08G257980 · TK1151

Golgi apparatus0.136

Rank 4 · TkA08G257980 · TK1151

Endoplasmic reticulum0.078

Rank 5 · TkA08G257980 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00069Pkinase48-306 aa

PF07714PK_Tyr_Ser-Thr49-300 aa

PF09373PMBR87-97 aa

PF01636APH88-155 aa

PF06293Kdo124-188 aa

PF03109ABC1124-202 aa

PF14531Kinase-like141-292 aa

PF24548EF_EFCAB10_C161-176 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G257980	`PF00069`	Pkinase	48	306	1.5e-78	264.5
TkA08G257980	`PF07714`	PK_Tyr_Ser-Thr	49	300	3.1e-28	99.5
TkA08G257980	`PF09373`	PMBR	87	97	0.069	14.0
TkA08G257980	`PF01636`	APH	88	155	0.054	14.0
TkA08G257980	`PF06293`	Kdo	124	188	5.9e-05	23.3
TkA08G257980	`PF03109`	ABC1	124	202	0.0059	16.5
TkA08G257980	`PF14531`	Kinase-like	141	292	0.034	14.1
TkA08G257980	`PF24548`	EF_EFCAB10_C	161	176	9.9e-10	38.6
TkA08G257980	`PF01636`	APH	166	183	0.054	14.0
TkA08G257980	`PF29176`	Allatotropin-like_C	279	301	0.46	10.8
TkA08G257980	`PF23564`	EF-hand_FSTL1	281	299	0.00034	21.7
TkA08G257980	`PF13499`	EF-hand_7	285	300	1.3e-28	99.9
TkA08G257980	`PF13405`	EF-hand_6	285	301	1.3e-28	96.6
TkA08G257980	`PF13833`	EF-hand_8	335	376	5.3e-18	65.2
TkA08G257980	`PF12763`	EH	346	414	4.9e-08	33.6
TkA08G257980	`PF25825`	SAPC2_N	347	413	0.00054	20.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q42396`	Arabidopsis thaliana	sp\|Q42396\|CDPKC_ARATH Calcium-dependent protein kinase 12	78.000%	Swiss-Prot	High
`Q38869`	Arabidopsis thaliana	sp\|Q38869\|CDPK4_ARATH Calcium-dependent protein kinase 4	75.900%	Swiss-Prot	High
`Q2QX45`	Oryza sativa subsp. japonica	sp\|Q2QX45\|CDPKS_ORYSJ Calcium-dependent protein kinase 28	76.100%	Swiss-Prot	High
`Q9FXQ3`	Oryza sativa subsp. japonica	sp\|Q9FXQ3\|CDPKD_ORYSJ Calcium-dependent protein kinase 13	72.400%	Swiss-Prot	High
`Q53P85`	Oryza sativa subsp. japonica	sp\|Q53P85\|CDPKO_ORYSJ Calcium-dependent protein kinase 24	74.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card