TkA08G251590 | RubberDandelionOmics

Gene overview

TkA08G251590

Reference: TK1151 Chr: Chr08 Coordinates: 65685721-65687826 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1422 bp · TkA08G251590|TK1151|cDNA

TTGATTTCTTATTTTCTTCTCTGATTCTATGGAAACACCAATATCAGACACGATTTCTTATTCTTCTGTTTAGATACAGAAATTCGATTTTTGAAGACTAGCCATCTTATTTGTGAAATACCTTCGATACCTGGTTCTGATATACGATTTCTTTGCGAACTTCTGATTCTTTTGAAGACTGAAGTTCGATTCCCTTTTCCATATCACGGGCTCAACCTCGGGTACTTTTGATGGTGAGACGAATCATTTCACGCTCCTCA...

CDS

Download CDS FASTA

912 bp · TkA08G251590|TK1151|CDS

ATGGAGGCAAAGGCATCATCTCCCACAGATATTGTTGTCGAGGAATTCAACAAGATAAAGAAAGATTGGGAAGATGGGTATGTTCAAACCCTAGACCACATTCACGCCATCGAACAATACGGGAAATCAAGATCCCCCGGCGACGACGCCAGGAAAGATTCCTTACCCAGATTGAACGGCGTCGCTCAAGACGGACTATCTTTGTTGGTTACGGCACAATTCAATCTCGATCTTTTGGCCCCTCAGCTTCCCACAGATGA...

Protein

Download Protein FASTA

303 aa · TkA08G251590|TK1151|PROTEIN

MEAKASSPTDIVVEEFNKIKKDWEDGYVQTLDHIHAIEQYGKSRSPGDDARKDSLPRLNGVAQDGLSLLVTAQFNLDLLAPQLPTDDHIQKARTLLQSWSKEIQSLRSSLRHANLQAKANMRKAAKEERELLLGGGEESTARRRNLQTKAGMTSAAESITESLRRTRQLMVQEVERSGNTLMAFEESTGVLKKAESEYKGHRSLLTRTRNLLSTMKRQDVLDRIILIVGFLLFSLAVLYVVSKRIGILKLQRKVIGAIKA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G251590`
TK1151 ID	TkA08G251590
OH-1004 ID	LXL04_033338
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA08G251590`
Location	Chr08:65685721-65687826 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_033338` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006886 intracellular protein transport Biological Process GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process GO:0007029 endoplasmic reticulum organization Biological Process GO:0014823 response to activity Biological Process GO:0015031 protein transport Biological Process GO:0016320 endoplasmic reticulum membrane fusion Biological Process GO:0042594 response to starvation Biological Process GO:0090649 response to oxygen-glucose deprivation Biological Process GO:0005635 nuclear envelope Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005741 mitochondrial outer membrane Cellular Component GO:0005783 endoplasmic reticulum Cellular Component
KEGG gene cross-reference	hsa:662 mmu:224630 rno:140932 spo:2541996 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.649

Rank 1 · TkA08G251590 · TK1151

Golgi apparatus0.223

Rank 2 · TkA08G251590 · TK1151

Cytoplasm0.095

Rank 3 · TkA08G251590 · TK1151

Nucleus0.082

Rank 4 · TkA08G251590 · TK1151

Cell membrane0.044

Rank 5 · TkA08G251590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27021BOS1_GOSR2_MEM11-like_N45-134 aa

PF09177STX6_10_61_N87-121 aa

PF03908Sec20103-103 aa

PF27021BOS1_GOSR2_MEM11-like_N144-172 aa

PF03908Sec20154-245 aa

PF09177STX6_10_61_N154-218 aa

PF31148NfeD_C155-175 aa

PF27021BOS1_GOSR2_MEM11-like_N196-219 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G251590	`PF27021`	BOS1_GOSR2_MEM11-like_N	45	134	0.01	16.8
TkA08G251590	`PF09177`	STX6_10_61_N	87	121	8.1	7.8
TkA08G251590	`PF03908`	Sec20	103	103	5.1e-29	100.8
TkA08G251590	`PF27021`	BOS1_GOSR2_MEM11-like_N	144	172	0.01	16.8
TkA08G251590	`PF03908`	Sec20	154	245	5.1e-29	100.8
TkA08G251590	`PF09177`	STX6_10_61_N	154	218	8.1	7.8
TkA08G251590	`PF31148`	NfeD_C	155	175	0.15	12.8
TkA08G251590	`PF27021`	BOS1_GOSR2_MEM11-like_N	196	219	0.01	16.8
TkA08G251590	`PF31148`	NfeD_C	253	281	0.15	12.8
TkA08G251590	`PF09177`	STX6_10_61_N	267	283	8.1	7.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card