Gene Card
Gene overview
cDNA / CDS / Protein Sequences
912 bp · LXL04_033338|LXL04_033338|OH1004|cDNA
ATGGAGGCAAAGGCATCATCTCCCACAGATATTGTTGTCGAGGAATTCAACAAGATAAAGAAAGATTGGGAAGATGGGTATGTTCAAACCCTAGACCACATTCACGCCATCGAACTATACGGGAAATCTAGATCCACCGGCGACGACGCCAGGAAAGATTCCTTACCCAGATTGAACGGCGTCGCTCAAGACGGACTATCTTTGCTGGTTACGGCACAATTCAATCTCGATCTTTTGGCCCCTCAGCTTCCCACAGATGA...
912 bp · LXL04_033338|LXL04_033338|OH1004|CDS
ATGGAGGCAAAGGCATCATCTCCCACAGATATTGTTGTCGAGGAATTCAACAAGATAAAGAAAGATTGGGAAGATGGGTATGTTCAAACCCTAGACCACATTCACGCCATCGAACTATACGGGAAATCTAGATCCACCGGCGACGACGCCAGGAAAGATTCCTTACCCAGATTGAACGGCGTCGCTCAAGACGGACTATCTTTGCTGGTTACGGCACAATTCAATCTCGATCTTTTGGCCCCTCAGCTTCCCACAGATGA...
Protein
Download Protein FASTA303 aa · LXL04_033338|LXL04_033338|OH1004|PROTEIN
MEAKASSPTDIVVEEFNKIKKDWEDGYVQTLDHIHAIELYGKSRSTGDDARKDSLPRLNGVAQDGLSLLVTAQFNLDLLAPQLPTDDHIQNARTLLQSWSKEIQSLRSSLRHANLQAKANMRKAAKEERELLLGGGEESTARRRNLQTKAGMTSAAESITESLRRTRQLMVQEVERSGNTLMAFEESTGVLKKAESEYKGHRSLLTRTRNLLSTMKRQDVLDRIILIVGFLLFSLAVLYVVSKRIGILKLQRKVIGAIKA...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | LXL04_033338 |
|---|---|
| Source version | OH-1004 / GCA_047496595.1_OSU_TarKok_2.0 |
SNP / Indel variants and carrier samplesCRA009020 · OH-1004
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | LXL04_033338 |
|---|---|
| Location | Chr07:41092979-41094571 (-) |
| Description | Protein of unknown function |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006886 intracellular protein transport Biological Process GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum Biological Process GO:0007029 endoplasmic reticulum organization Biological Process GO:0014823 response to activity Biological Process GO:0015031 protein transport Biological Process GO:0016320 endoplasmic reticulum membrane fusion Biological Process GO:0042594 response to starvation Biological Process GO:0090649 response to oxygen-glucose deprivation Biological Process GO:0005635 nuclear envelope Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005741 mitochondrial outer membrane Cellular Component GO:0005783 endoplasmic reticulum Cellular Component |
| KEGG gene cross-reference | hsa:662 mmu:224630 rno:140932 spo:2541996 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF03908.19Sec20154-245 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| LXL04_033338 | PF03908.19 | Sec20 | 154 | 245 | 5.1e-29 | 100.8 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.