RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA08G059040
Reference: TK1151 Chr: Chr08 Coordinates: 15122965-15126161 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2976 bp · TkA08G059040|TK1151|cDNA

AGCTTTTCACGGGTACATATAACATACTCCATACAAAAAGACAAACCCCCTAAATTACTATATGTCACTCTCACTTCACGGATTCACCTTCTTCACCATATCTCCCCCTTTCTCTCTGTTACTTCTCCAATGGCGTCTCACTGTCCACTCTCACTCTCACTCACATTCCTCCTACTCTTCACCATTAATGCTTCATCATCACCTTCGCCATCAACTTCATCAGAAGCCGACATTCTTTTGACCTTCAAATCCGCCATTAA...

CDS

Download CDS FASTA

2778 bp · TkA08G059040|TK1151|CDS

AGCTTTTCACGGGTACATATAACATACTCCATACAAAAAGACAAACCCCCTAAATTACTATATGTCACTCTCACTTCACGGATTCACCTTCTTCACCATATCTCCCCCTTTCTCTCTGTTACTTCTCCAATGGCGTCTCACTGTCCACTCTCACTCTCACTCACATTCCTCCTACTCTTCACCATTAATGCTTCATCATCACCTTCGCCATCAACTTCATCAGAAGCCGACATTCTTTTGACCTTCAAATCCGCCATTAA...

Protein

Download Protein FASTA

925 aa · TkA08G059040|TK1151|PROTEIN

SFSRVHITYSIQKDKPPKLLYVTLTSRIHLLHHISPFLSVTSPMASHCPLSLSLTFLLLFTINASSSPSPSTSSEADILLTFKSAINDPMNYLASWSNTTITHHCNWTGVVCTSTTTAAAAVSSLILQNFNLSGEISPSVCQLANLVTLNLADNFFNQPIPLHISQCSSLNTLNLSSNLIWGTIPDQISQFKSLKFLDLSKNHVEGRIPDGVGSLLNLQVLNFGNNLLSGSVPTVIGNFTELIVLDLSLNPFMESEIPSD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA08G059040
TK1151 IDTkA08G059040
OH-1004 IDLXL04_018416
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)99.900
Protein coverage (%)TK1151 100.000 / OH-1004 96.757
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA08G059040
LocationChr08:15122965-15126161 (-)
DescriptionSimilar to At5g06940: Probably inactive leucine-rich repeat receptor-like protein kinase At5g06940
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g06940 Probably inactive leucine-rich repeat receptor-like protein kinase At5g06940. No verified direct reference in this release
At5g49660 Receptor kinase involved in the perception of C-terminally encoded plant signaling peptide (CEP) and subsequent regulation of root and shoot development.
XYLEM INTERMIXED WITH PHLOEM1, a leucine-rich repeat receptor-like kinase required for stem growth and vascular development in Arabidopsis thaliana.2012 · DOI: 10.1007/s00425-011-1489-6
CEP5 and XIP1/CEPR1 regulate lateral root initiation in Arabidopsis.2016 · DOI: 10.1093/jxb/erw231
At5g65700 LRR-rich receptor-like kinase (LRR-RLK) that, similarly to CLV1 and BAM3, participates in the detection of the CLAVATA-family peptides (e.g. CLE25, CLE26 and CLE45), and to the regulation of the triggered signaling required for protophloem differentiation and meristems maintenance through the phosphorylation of CIK proteins (CIKs) and of PBL34, PBL35 and PBL36. No verified direct reference in this release
At5g63930 Probable leucine-rich repeat receptor-like protein kinase At5g63930. No verified direct reference in this release
At3g49670 LRR-rich receptor-like kinase (LRR-RLK) implicated in the detection of the CLAVATA-family peptides (CLEs), and to the regulation of the triggered signaling required for protophloem differentiation and meristems maintenance through the phosphorylation of CIK proteins (CIKs) and, probably, of PBL34, PBL35 and PBL36. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_018416 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006468 protein phosphorylation Biological Process
GO:0006952 defense response Biological Process
GO:0010067 procambium histogenesis Biological Process
GO:0010087 phloem or xylem histogenesis Biological Process
GO:0010102 lateral root morphogenesis Biological Process
GO:0010183 pollen tube guidance Biological Process
GO:0010227 floral organ abscission Biological Process
GO:0010468 regulation of gene expression Biological Process
GO:0030154 cell differentiation Biological Process
GO:0045490 pectin catabolic process Biological Process
GO:0046777 protein autophosphorylation Biological Process
GO:0050829 defense response to Gram-negative bacterium Biological Process
KEGG gene cross-reference
ath:AT1G28440
ath:AT4G28490
ath:AT4G28650
ath:AT5G06940
ath:AT5G65710
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.867
Rank 1 · TkA08G059040 · TK1151
Endoplasmic reticulum0.089
Rank 2 · TkA08G059040 · TK1151
Cytoplasm0.062
Rank 3 · TkA08G059040 · TK1151
Nucleus0.043
Rank 4 · TkA08G059040 · TK1151
Lysosome / Vacuole0.026
Rank 5 · TkA08G059040 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263LRRNT_274-113 aa
PF29594LRR_SKP2114-275 aa
PF25013LRR_Zer-1118-152 aa
PF13855LRR_8123-180 aa
PF00560LRR_1124-143 aa
PF12799LRR_4124-156 aa
PF23598LRR_14139-249 aa
PF23952LRR_EndoS143-202 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA08G059040PF08263LRRNT_2741134.6e-1246.7
TkA08G059040PF29594LRR_SKP21142750.004517.0
TkA08G059040PF25013LRR_Zer-11181521.7e-0835.4
TkA08G059040PF13855LRR_81231801.8e-2176.4
TkA08G059040PF00560LRR_11241432.9e-32104.4
TkA08G059040PF12799LRR_41241561.9e-2176.3
TkA08G059040PF23598LRR_141392495.9e-1968.7
TkA08G059040PF23952LRR_EndoS1432020.0614.3
TkA08G059040PF24758LRR_At5g563701442050.002718.1
TkA08G059040PF13516LRR_61441540.3811.6
TkA08G059040PF00560LRR_11451672.9e-32104.4
TkA08G059040PF13855LRR_81452031.8e-2176.4
TkA08G059040PF24048LRR_NXF1-51622050.0001222.4
TkA08G059040PF25013LRR_Zer-11652051.7e-0835.4
TkA08G059040PF13516LRR_61661780.3811.6
TkA08G059040PF29247LRR_MHP1-HER1-GIP31682030.03713.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FL51Arabidopsis thalianasp|Q9FL51|Y5694_ARATH Probably inactive leucine-rich repeat receptor-like protein kinase At5g0694052.700%Swiss-ProtLow
Q9FGL5Arabidopsis thalianasp|Q9FGL5|CEPR1_ARATH Receptor protein-tyrosine kinase CEPR135.600%Swiss-ProtLow
O49545Arabidopsis thalianasp|O49545|BAME1_ARATH Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM136.000%Swiss-ProtLow
Q9LVP0Arabidopsis thalianasp|Q9LVP0|Y5639_ARATH Probable leucine-rich repeat receptor-like protein kinase At5g6393036.400%Swiss-ProtLow
Q9M2Z1Arabidopsis thalianasp|Q9M2Z1|BAME2_ARATH Leucine-rich repeat receptor-like serine/threonine-protein kinase BAM235.100%Swiss-ProtLow

JBrowse

View in Genome Browser