RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

LXL04_018416
Reference: OH-1004 Chr: Chr04 Coordinates: 12597775-12602060 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2871 bp · LXL04_018416|LXL04_018416|OH1004|cDNA

ATGTACGACGTACTTATCCGGTACAACACAACCATCTACAAATGCACATCAACATCCGCTATACAGTTTATCTCGAGAAGAGTCTCCATGTATAGCTTTTCACGGGTACATATAACATACTCCATACAAAAAGACAAACCCCCTAAATTACTATATGTCACTCTCACTTCACGGATTCACCTTCTTCACCATATCTCCCCCTTTCTCTCTGTTACTTCTCCAATGGCGTCTCACTGTCCACTCTCACTCTCACTCACATT...

CDS

Download CDS FASTA

2871 bp · LXL04_018416|LXL04_018416|OH1004|CDS

ATGTACGACGTACTTATCCGGTACAACACAACCATCTACAAATGCACATCAACATCCGCTATACAGTTTATCTCGAGAAGAGTCTCCATGTATAGCTTTTCACGGGTACATATAACATACTCCATACAAAAAGACAAACCCCCTAAATTACTATATGTCACTCTCACTTCACGGATTCACCTTCTTCACCATATCTCCCCCTTTCTCTCTGTTACTTCTCCAATGGCGTCTCACTGTCCACTCTCACTCTCACTCACATT...

Protein

Download Protein FASTA

956 aa · LXL04_018416|LXL04_018416|OH1004|PROTEIN

MYDVLIRYNTTIYKCTSTSAIQFISRRVSMYSFSRVHITYSIQKDKPPKLLYVTLTSRIHLLHHISPFLSVTSPMASHCPLSLSLTFLLLFTINASSSPSPSTSSEADILLTFKSAINDPMNYLASWSNTTITHHCNWTGVVCTSTTTAAAAVSSLILQNFNLSGEISPSVCQLANLVTLNLADNFFNQPIPLHISQCSSLNTLNLSSNLIWGTIPDQISQFKSLKFLDLSKNHVEGRIPDGVGSLLNLQVLNFGNNLLS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDLXL04_018416
Source versionOH-1004 / GCA_047496595.1_OSU_TarKok_2.0
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDLXL04_018416
LocationChr04:12597775-12602060 (-)
DescriptionSimilar to At5g06940: Probably inactive leucine-rich repeat receptor-like protein kinase At5g06940
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At5g06940 Probably inactive leucine-rich repeat receptor-like protein kinase At5g06940. No verified direct reference in this release
At1g28440 Receptor-like protein kinase HSL1. No verified direct reference in this release
At5g65710 Receptor-like serine/threonine-kinase acting on substrates that controls floral organ abscission. No verified direct reference in this release
At4g28490 Receptor with a dual specificity kinase activity acting on both serine/threonine- and tyrosine-containing substrates that controls floral organ abscission. No verified direct reference in this release
At4g28650 Involved in the regulation of procambium maintenance and polarity during vascular-tissue development.
A receptor heteromer mediates the male perception of female attractants in plants.2016 · DOI: 10.1038/nature16975

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_018416 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)
GO:0006468 protein phosphorylation Biological Process
GO:0006952 defense response Biological Process
GO:0010067 procambium histogenesis Biological Process
GO:0010087 phloem or xylem histogenesis Biological Process
GO:0010102 lateral root morphogenesis Biological Process
GO:0010183 pollen tube guidance Biological Process
GO:0010227 floral organ abscission Biological Process
GO:0010468 regulation of gene expression Biological Process
GO:0030154 cell differentiation Biological Process
GO:0045490 pectin catabolic process Biological Process
GO:0046777 protein autophosphorylation Biological Process
GO:0050829 defense response to Gram-negative bacterium Biological Process
KEGG gene cross-reference
ath:AT1G28440
ath:AT4G28490
ath:AT4G28650
ath:AT5G06940
ath:AT5G65710
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.862
Rank 1 · LXL04_018416 · OH-1004
Endoplasmic reticulum0.091
Rank 2 · LXL04_018416 · OH-1004
Cytoplasm0.064
Rank 3 · LXL04_018416 · OH-1004
Nucleus0.046
Rank 4 · LXL04_018416 · OH-1004
Lysosome / Vacuole0.027
Rank 5 · LXL04_018416 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_2105-144 aa
PF23598.2LRR_14170-280 aa
PF13855.13LRR_8176-234 aa
PF23598.2LRR_14267-460 aa
PF13855.13LRR_8322-381 aa
PF12799.14LRR_4495-529 aa
PF13855.13LRR_8514-572 aa
PF07714.24PK_Tyr_Ser-Thr679-943 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
LXL04_018416PF08263.18LRRNT_21051444.9e-1246.6
LXL04_018416PF23598.2LRR_141702806.2e-1968.7
LXL04_018416PF13855.13LRR_81762342.3e-2176.0
LXL04_018416PF23598.2LRR_142674606.2e-1968.7
LXL04_018416PF13855.13LRR_83223812.3e-2176.0
LXL04_018416PF12799.14LRR_44955292.8e-2175.8
LXL04_018416PF13855.13LRR_85145722.3e-2176.0
LXL04_018416PF07714.24PK_Tyr_Ser-Thr6799433.3e-38132.2
LXL04_018416PF00069.32Pkinase6829423.5e-38132.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9FL51Arabidopsis thalianaProbably inactive leucine-rich repeat receptor-like protein kinase At5g0694058.768%Swiss-Protstrong database homology
Q9SGP2Arabidopsis thalianaReceptor-like protein kinase HSL133.058%Swiss-Protmoderate database homology
C0LGX3Arabidopsis thalianaLRR receptor-like serine/threonine-protein kinase HSL232.891%Swiss-Protmoderate database homology
P47735Arabidopsis thalianaReceptor-like protein kinase 534.051%Swiss-Protmoderate database homology
Q9M0G7Arabidopsis thalianaMDIS1-interacting receptor like kinase 133.164%Swiss-Protmoderate database homology

JBrowse

View in Genome Browser