RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA08G040880
Reference: TK1151 Chr: Chr08 Coordinates: 10390738-10398357 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

5558 bp · TkA08G040880|TK1151|cDNA

TTTCATCAACCGTAAATGTAATGGACAAAATATAGTTTTTAAGTTGAGTAGAAATATCGTTTTGATTTTTGAACTCGTCTCTTTAATCCCAATGTTCATGCAAGATTTCTCAAAAAACCCTCATTAAATCGCAGCAAAAGCGTACGGTGGATTGATTCGTCTCAACTGCTGAAAATATTCTTACGCGATTTTCTGAAAAAGCGGAATCAAAACCCTTCTATTCTCAGCGGTAGACTAATTGGCAAAAGTTCCACAACATT...

CDS

Download CDS FASTA

3951 bp · TkA08G040880|TK1151|CDS

ATGCATTCCTCGGAGATTTCAGCAAGCTCAACAAACCCCTCGAAGAGAATTTCTGAAACGATGATAAACGATCCTGCTAATAGTAAAAAACCCAGACTTTCCGAAGTCGAGATGATACCCCACTCTAATTTGACACCCAGAGAGTATCAATTGGATGTGTTTAAAGTGGCTATGCGACGAAATACCATAGCTCATCTGGACACCGGTGCCGGAAAAACAATAATAGCTGTCATGATCATCAAACAAGTAGCGCTTTCTCT...

Protein

Download Protein FASTA

1316 aa · TkA08G040880|TK1151|PROTEIN

MHSSEISASSTNPSKRISETMINDPANSKKPRLSEVEMIPHSNLTPREYQLDVFKVAMRRNTIAHLDTGAGKTIIAVMIIKQVALSLTTQPSEKKLIIFLAPTRNLVEQQFKVLKENTDLTVDFYHGTKVGTMNGKKVDEWDAAVWEHETDKNQIMVMTPQILLDALRNAFINFETICLLIIDECHRASGNHPYVSIMKEFYLKSVNKPKVFGMTASPVTKKGVSSTEDCETQITTLESVLDSLVYTLRNRKELENVTPS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA08G040880
TK1151 IDTkA08G040880
OH-1004 IDLXL04_017915
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)99.200
Protein coverage (%)TK1151 99.544 / OH-1004 80.098
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA08G040880
LocationChr08:10390738-10398357 (-)
DescriptionSimilar to DCL3A: Endoribonuclease Dicer homolog 3a
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At3g43920 Ribonuclease (RNase) III involved in RNA-mediated post- transcriptional gene silencing (PTGS).
Partially redundant functions of Arabidopsis DICER-like enzymes and a role for DCL4 in producing trans-acting siRNAs.2005 · DOI: 10.1016/j.cub.2005.07.024
An antagonistic function for Arabidopsis DCL2 in development and a new function for DCL4 in generating viral siRNAs.2006 · DOI: 10.1038/sj.emboj.7601217
Suppression of antiviral silencing by cucumber mosaic virus 2b protein in Arabidopsis is associated with drastically reduced accumulation of three classes of viral small interfering RNAs.2007 · DOI: 10.1105/tpc.106.047449
At1g01040 Ribonuclease (RNase) III involved in RNA-mediated post- transcriptional gene silencing (PTGS).
Specific interactions between Dicer-like proteins and HYL1/DRB-family dsRNA-binding proteins in Arabidopsis thaliana.2005 · DOI: 10.1007/s11103-004-6853-5
Partially redundant functions of Arabidopsis DICER-like enzymes and a role for DCL4 in producing trans-acting siRNAs.2005 · DOI: 10.1016/j.cub.2005.07.024
The interaction between DCL1 and HYL1 is important for efficient and precise processing of pri-miRNA in plant microRNA biogenesis.2006 · DOI: 10.1261/rna.2146906
A novel class of bacteria-induced small RNAs in Arabidopsis.2007 · DOI: 10.1101/gad.1595107
The RNA-binding proteins HYL1 and SE promote accurate in vitro processing of pri-miRNA by DCL1.2008 · DOI: 10.1073/pnas.0803356105
Arabidopsis DRB4, AGO1, AGO7, and RDR6 participate in a DCL4-initiated antiviral RNA silencing pathway negatively regulated by DCL1.2008 · DOI: 10.1073/pnas.0805760105

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0909200 Probably involved in the RNA silencing pathway. No verified direct reference in this release
Os10g0485600 Probably involved in the RNA silencing pathway. No verified direct reference in this release
Os04g0509300 Involved in the RNA silencing pathway.
The small interfering RNA production pathway is required for shoot meristem initiation in rice.2007 · DOI: 10.1073/pnas.0704339104
Oryza sativa dicer-like4 reveals a key role for small interfering RNA silencing in plant development.2007 · DOI: 10.1105/tpc.107.052209
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_017915 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006353 DNA-templated transcription termination Biological Process
GO:0009616 RNAi-mediated antiviral immune response Biological Process
GO:0009944 polarity specification of adaxial/abaxial axis Biological Process
GO:0010050 vegetative phase change Biological Process
GO:0010267 ta-siRNA processing Biological Process
GO:0010492 maintenance of shoot apical meristem identity Biological Process
GO:0010599 lsiRNA processing Biological Process
GO:0030422 siRNA processing Biological Process
GO:0044027 negative regulation of gene expression via chromosomal CpG island methylation Biological Process
GO:0048608 reproductive structure development Biological Process
GO:0051214 RNAi-mediated antiviral immunity against RNA virus Biological Process
GO:0051607 defense response to virus Biological Process
KEGG gene cross-reference
ath:AT3G43920
ath:AT5G20320
dosa:Os01g0909200
dosa:Os04g0509300
dosa:Os10g0485600
osa:4324864
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.676
Rank 1 · TkA08G040880 · TK1151
Cytoplasm0.352
Rank 2 · TkA08G040880 · TK1151
Mitochondrion0.043
Rank 3 · TkA08G040880 · TK1151
Cell membrane0.040
Rank 4 · TkA08G040880 · TK1151
Endoplasmic reticulum0.028
Rank 5 · TkA08G040880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04851ResIII45-218 aa
PF00270DEAD48-218 aa
PF07517SecA_DEAD55-86 aa
PF18766SWI2_SNF261-228 aa
PF00176SNF2-rel_dom61-192 aa
PF00271Helicase_C91-129 aa
PF18766SWI2_SNF2286-326 aa
PF00270DEAD308-329 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA08G040880PF04851ResIII452181.1e-1868.4
TkA08G040880PF00270DEAD482181.3e-2074.6
TkA08G040880PF07517SecA_DEAD55860.2411.3
TkA08G040880PF18766SWI2_SNF2612280.0002321.6
TkA08G040880PF00176SNF2-rel_dom611920.01715.0
TkA08G040880PF00271Helicase_C911291.6e-1867.7
TkA08G040880PF18766SWI2_SNF22863260.0002321.6
TkA08G040880PF00270DEAD3083291.3e-2074.6
TkA08G040880PF00271Helicase_C4055211.6e-1867.7
TkA08G040880PF03368Dicer_dimer5946752.3e-2382.7
TkA08G040880PF14622Ribonucleas_3_36456811.7e-2177.4
TkA08G040880PF00636Ribonuclease_36497165.1e-32111.4
TkA08G040880PF02170PAZ8749944.6e-1349.9
TkA08G040880PF14622Ribonucleas_3_3105611141.7e-2177.4
TkA08G040880PF00636Ribonuclease_3105711915.1e-32111.4
TkA08G040880PF14622Ribonucleas_3_3117412011.7e-2177.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9LXW7Arabidopsis thalianasp|Q9LXW7|DCL3_ARATH Endoribonuclease Dicer homolog 344.200%Swiss-ProtMedium
Q9SP32Arabidopsis thalianasp|Q9SP32|DCL1_ARATH Endoribonuclease Dicer homolog 132.500%Swiss-ProtMedium
Q5N870Oryza sativa subsp. japonicasp|Q5N870|DCL3A_ORYSJ Endoribonuclease Dicer homolog 3a49.500%Swiss-ProtMedium
Q7XD96Oryza sativa subsp. japonicasp|Q7XD96|DCL3B_ORYSJ Endoribonuclease Dicer homolog 3b47.500%Swiss-ProtMedium
A7LFZ6Oryza sativa subsp. japonicasp|A7LFZ6|DCL4_ORYSJ Endoribonuclease Dicer homolog 434.500%Swiss-ProtMedium

JBrowse

View in Genome Browser