LXL04_017915 | RubberDandelionOmics

Gene overview

LXL04_017915

Reference: OH-1004 Chr: Chr04 Coordinates: 3526462-3533485 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4917 bp · LXL04_017915|LXL04_017915|OH1004|cDNA

ATGCATTCCTCGGAGATTTCAGCAAGCTCAACAAACCCCTCGAAGAGAATTTCTGAAACGATGATAAACGATCCTGCTAATAGTAAAAAACCCAGACTTTCCGAAGTCGAGATGATACCCCACTCTAATTTGACACCCAGAGAGTATCAATTGGATGTGTTTAAAGTGGCTATGCGGCGAAATACCATAGCTCATCTGGACACCGGTGCCGGAAAAACAATGATAGCTGTCATGATCATCAAACAAGTAGCGCTTTCTCT...

CDS

Download CDS FASTA

4917 bp · LXL04_017915|LXL04_017915|OH1004|CDS

ATGCATTCCTCGGAGATTTCAGCAAGCTCAACAAACCCCTCGAAGAGAATTTCTGAAACGATGATAAACGATCCTGCTAATAGTAAAAAACCCAGACTTTCCGAAGTCGAGATGATACCCCACTCTAATTTGACACCCAGAGAGTATCAATTGGATGTGTTTAAAGTGGCTATGCGGCGAAATACCATAGCTCATCTGGACACCGGTGCCGGAAAAACAATGATAGCTGTCATGATCATCAAACAAGTAGCGCTTTCTCT...

Protein

Download Protein FASTA

1638 aa · LXL04_017915|LXL04_017915|OH1004|PROTEIN

MHSSEISASSTNPSKRISETMINDPANSKKPRLSEVEMIPHSNLTPREYQLDVFKVAMRRNTIAHLDTGAGKTMIAVMIIKQVALSLTTQPSEKKLIIFLAPTRNLVEQQFKVLKENTDLTVDFYHGTKVGTMNGKKVDEWDAAVWEHETDKNQIMVMTPQILLDALRNAFINFETICLLIIDECHRASGNHPYVSIMKEFYLKSVNKPKVFGMTASPVTKKGVSSTEDCETQITTLESVLDSLVYTLRNRKELENVTPS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017915`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017915

Location Chr04:3526462-3533485 (+)

Description Similar to DCL3A: Endoribonuclease Dicer homolog 3a

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g43920`	Ribonuclease (RNase) III involved in RNA-mediated post- transcriptional gene silencing (PTGS).	Partially redundant functions of Arabidopsis DICER-like enzymes and a role for DCL4 in producing trans-acting siRNAs.2005 · DOI: 10.1016/j.cub.2005.07.024 An antagonistic function for Arabidopsis DCL2 in development and a new function for DCL4 in generating viral siRNAs.2006 · DOI: 10.1038/sj.emboj.7601217 Suppression of antiviral silencing by cucumber mosaic virus 2b protein in Arabidopsis is associated with drastically reduced accumulation of three classes of viral small interfering RNAs.2007 · DOI: 10.1105/tpc.106.047449
`At5g20320`	Ribonuclease (RNase) III involved in RNA-mediated post- transcriptional gene silencing (PTGS).	Partially redundant functions of Arabidopsis DICER-like enzymes and a role for DCL4 in producing trans-acting siRNAs.2005 · DOI: 10.1016/j.cub.2005.07.024 DICER-LIKE 4 functions in trans-acting small interfering RNA biogenesis and vegetative phase change in Arabidopsis thaliana.2005 · DOI: 10.1073/pnas.0506426102 A pathway for the biogenesis of trans-acting siRNAs in Arabidopsis.2005 · DOI: 10.1101/gad.1352605 DICER-LIKE 4 is required for RNA interference and produces the 21-nucleotide small interfering RNA component of the plant cell-to-cell silencing signal.2005 · DOI: 10.1038/ng1675 DRB4-dependent TAS3 trans-acting siRNAs control leaf morphology through AGO7.2006 · DOI: 10.1016/j.cub.2006.03.035 An antagonistic function for Arabidopsis DCL2 in development and a new function for DCL4 in generating viral siRNAs.2006 · DOI: 10.1038/sj.emboj.7601217 Suppression of antiviral silencing by cucumber mosaic virus 2b protein in Arabidopsis is associated with drastically reduced accumulation of three classes of viral small interfering RNAs.2007 · DOI: 10.1105/tpc.106.047449 Transitivity in Arabidopsis can be primed, requires the redundant action of the antiviral Dicer-like 4 and Dicer-like 2, and is compromised by viral-encoded suppressor proteins.2007 · DOI: 10.1261/rna.541307 A novel class of bacteria-induced small RNAs in Arabidopsis.2007 · DOI: 10.1101/gad.1595107 Arabidopsis DRB4, AGO1, AGO7, and RDR6 participate in a DCL4-initiated antiviral RNA silencing pathway negatively regulated by DCL1.2008 · DOI: 10.1073/pnas.0805760105

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0909200`	Probably involved in the RNA silencing pathway.	No verified direct reference in this release
`Os10g0485600`	Probably involved in the RNA silencing pathway.	No verified direct reference in this release
`Os04g0509300`	Involved in the RNA silencing pathway.	The small interfering RNA production pathway is required for shoot meristem initiation in rice.2007 · DOI: 10.1073/pnas.0704339104 Oryza sativa dicer-like4 reveals a key role for small interfering RNA silencing in plant development.2007 · DOI: 10.1105/tpc.107.052209

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017915 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006353 DNA-templated transcription termination Biological Process

GO:0009616 RNAi-mediated antiviral immune response Biological Process

GO:0009944 polarity specification of adaxial/abaxial axis Biological Process

GO:0010050 vegetative phase change Biological Process

GO:0010267 ta-siRNA processing Biological Process

GO:0010492 maintenance of shoot apical meristem identity Biological Process

GO:0010599 lsiRNA processing Biological Process

GO:0030422 siRNA processing Biological Process

GO:0044027 negative regulation of gene expression via chromosomal CpG island methylation Biological Process

GO:0048608 reproductive structure development Biological Process

GO:0051214 RNAi-mediated antiviral immunity against RNA virus Biological Process

GO:0051607 defense response to virus Biological Process

KEGG gene cross-reference

ath:AT3G43920

ath:AT5G20320

dosa:Os01g0909200

dosa:Os04g0509300

dosa:Os10g0485600

osa:4324864

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.711

Rank 1 · LXL04_017915 · OH-1004

Cytoplasm0.317

Rank 2 · LXL04_017915 · OH-1004

Cell membrane0.044

Rank 3 · LXL04_017915 · OH-1004

Mitochondrion0.035

Rank 4 · LXL04_017915 · OH-1004

Endoplasmic reticulum0.028

Rank 5 · LXL04_017915 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04851.22ResIII45-218 aa

PF00270.36DEAD48-218 aa

PF00271.38Helicase_C408-523 aa

PF03368.20Dicer_dimer596-677 aa

PF02170.29PAZ876-994 aa

PF14622.12Ribonucleas_3_31058-1116 aa

PF00636.32Ribonuclease_31059-1193 aa

PF14622.12Ribonucleas_3_31250-1378 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017915	`PF04851.22`	ResIII	45	218	1.1e-18	68.4
LXL04_017915	`PF00270.36`	DEAD	48	218	1.3e-20	74.5
LXL04_017915	`PF00271.38`	Helicase_C	408	523	4.7e-18	66.2
LXL04_017915	`PF03368.20`	Dicer_dimer	596	677	9.3e-27	93.6
LXL04_017915	`PF02170.29`	PAZ	876	994	4.8e-13	49.8
LXL04_017915	`PF14622.12`	Ribonucleas_3_3	1058	1116	2.8e-28	99.4
LXL04_017915	`PF00636.32`	Ribonuclease_3	1059	1193	2.9e-43	147.5
LXL04_017915	`PF14622.12`	Ribonucleas_3_3	1250	1378	2.8e-28	99.4
LXL04_017915	`PF00636.32`	Ribonuclease_3	1271	1379	2.9e-43	147.5
LXL04_017915	`PF00035.33`	dsrm	1409	1470	3.7e-07	31.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LXW7`	Arabidopsis thaliana	Endoribonuclease Dicer homolog 3	45.091%	Swiss-Prot	moderate database homology
`P84634`	Arabidopsis thaliana	Dicer-like protein 4	31.781%	Swiss-Prot	moderate database homology
`Q5N870`	Oryza sativa subsp. japonica	Endoribonuclease Dicer homolog 3a	47.914%	Swiss-Prot	moderate database homology
`Q7XD96`	Oryza sativa subsp. japonica	Endoribonuclease Dicer homolog 3b	46.687%	Swiss-Prot	moderate database homology
`A7LFZ6`	Oryza sativa subsp. japonica	Endoribonuclease Dicer homolog 4	34.375%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card