TkA08G036690 | RubberDandelionOmics

Gene overview

TkA08G036690

Reference: TK1151 Chr: Chr08 Coordinates: 9358316-9361371 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1039 bp · TkA08G036690|TK1151|cDNA

ATAACCTGCTTGTCGCTGAACATCTTTGTCCCCAAAACTCGCACAATCTCCCACTCTTCGCTTTTCGAATTCTTCCATGGAAAACAATGGCGACCACAGAAGCTATTGGGAATCCTTACTGCGAACCGAAGATTTCAACAGTTGGGGCGGATTCGAAGAAACGCTTTCCAGCTACTACGACTCCAGCTCGCCGGACGGTTCTCAGTCGGTGACCACCTCCAAGAACATCATGTCGGAGAGGAACCGGAGGAAGAAGCTCA...

CDS

Download CDS FASTA

726 bp · TkA08G036690|TK1151|CDS

ATGGAAAACAATGGCGACCACAGAAGCTATTGGGAATCCTTACTGCGAACCGAAGATTTCAACAGTTGGGGCGGATTCGAAGAAACGCTTTCCAGCTACTACGACTCCAGCTCGCCGGACGGTTCTCAGTCGGTGACCACCTCCAAGAACATCATGTCGGAGAGGAACCGGAGGAAGAAGCTCAATGATAGGCTCTTCGCACTCAGAGCGGTGGTCCCTAAGATTAGTAAGATGGATAAGGCGTCAATAATTAAAGATGC...

Protein

Download Protein FASTA

241 aa · TkA08G036690|TK1151|PROTEIN

MENNGDHRSYWESLLRTEDFNSWGGFEETLSSYYDSSSPDGSQSVTTSKNIMSERNRRKKLNDRLFALRAVVPKISKMDKASIIKDAIEYIQILHDQERTIQAELTELEARKLESGMLDISQETGFMSPESLKKKRLDQAFDPSGSNSYPIEVLELNVSYVGEKTVLVSLKCIKRRDTIVKLCEVFESLKLKIVTANISVLSERLFNTLFIQADEGEMEFLKIQIETAISALSNSQSPMSM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G036690`
TK1151 ID	TkA08G036690
OH-1004 ID	LXL04_017961
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G036690

Location Chr08:9358316-9361371 (+)

Description Similar to BHLH35: Transcription factor bHLH35

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g57150`	Transcription factor bHLH35.	No verified direct reference in this release
`At4g29930`	Transcription factor bHLH27.	No verified direct reference in this release
`At2g16910`	Transcription factor.	No verified direct reference in this release
`At4g17880`	Transcription factor involved in jasmonic acid (JA) gene regulation.	Characterization of JAZ-interacting bHLH transcription factors that regulate jasmonate responses in Arabidopsis.2011 · DOI: 10.1093/jxb/erq408 The Arabidopsis bHLH transcription factors MYC3 and MYC4 are targets of JAZ repressors and act additively with MYC2 in the activation of jasmonate responses.2011 · DOI: 10.1105/tpc.110.080788 Arabidopsis basic helix-loop-helix transcription factors MYC2, MYC3, and MYC4 regulate glucosinolate biosynthesis, insect performance, and feeding behavior.2013 · DOI: 10.1105/tpc.113.115139

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0301500`	Transcription factor involved in phosphate starvation response.	RERJ1, a jasmonic acid-responsive gene from rice, encodes a basic helix-loop-helix protein.2004 · DOI: 10.1016/j.bbrc.2004.10.126 Stress-induced expression of the transcription factor RERJ1 is tightly regulated in response to jasmonic acid accumulation in rice.2013 · DOI: 10.1007/s00709-012-0400-z OsbHLH6 interacts with OsSPX4 and regulates the phosphate starvation response in rice.2021 · DOI: 10.1111/tpj.15061

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017961 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009555 pollen development Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0010039 response to iron ion Biological Process

GO:0034756 regulation of iron ion transport Biological Process

GO:0048658 anther wall tapetum development Biological Process

GO:0048831 regulation of shoot system development Biological Process

GO:0055062 phosphate ion homeostasis Biological Process

GO:0080040 positive regulation of cellular response to phosphate starvation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G16910

ath:AT2G28160

ath:AT4G29930

ath:AT5G57150

dosa:Os04g0301500

osa:4335417

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.953

Rank 1 · TkA08G036690 · TK1151

Cytoplasm0.134

Rank 2 · TkA08G036690 · TK1151

Cell membrane0.029

Rank 3 · TkA08G036690 · TK1151

Endoplasmic reticulum0.015

Rank 4 · TkA08G036690 · TK1151

Plastid0.010

Rank 5 · TkA08G036690 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010HLH50-94 aa

PF23177bHLH_IRO350-109 aa

PF17908APAF1_C52-108 aa

PF23173bHLH_SAC5153-95 aa

PF22754bHLH-TF_ACT-like_plant155-230 aa

PF17908APAF1_C165-187 aa

PF23177bHLH_IRO3178-191 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G036690	`PF00010`	HLH	50	94	1.9e-11	44.3
TkA08G036690	`PF23177`	bHLH_IRO3	50	109	2.2e-07	31.9
TkA08G036690	`PF17908`	APAF1_C	52	108	0.22	12.1
TkA08G036690	`PF23173`	bHLH_SAC51	53	95	0.00021	21.9
TkA08G036690	`PF22754`	bHLH-TF_ACT-like_plant	155	230	3e-22	79.2
TkA08G036690	`PF17908`	APAF1_C	165	187	0.22	12.1
TkA08G036690	`PF23177`	bHLH_IRO3	178	191	2.2e-07	31.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q2HIV9`	Arabidopsis thaliana	sp\|Q2HIV9\|BH035_ARATH Transcription factor bHLH35	53.800%	Swiss-Prot	High
`Q700E3`	Arabidopsis thaliana	sp\|Q700E3\|BH027_ARATH Transcription factor bHLH27	47.700%	Swiss-Prot	Medium
`Q9ZVX2`	Arabidopsis thaliana	sp\|Q9ZVX2\|AMS_ARATH Transcription factor ABORTED MICROSPORES	32.000%	Swiss-Prot	Medium
`O49687`	Arabidopsis thaliana	sp\|O49687\|MYC4_ARATH Transcription factor MYC4	30.400%	Swiss-Prot	Medium
`Q0JEB7`	Oryza sativa subsp. japonica	sp\|Q0JEB7\|BH006_ORYSJ Transcription factor BHLH6	38.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card