LXL04_017961 | RubberDandelionOmics

Gene overview

LXL04_017961

Reference: OH-1004 Chr: Chr04 Coordinates: 4321998-4325046 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

726 bp · LXL04_017961|LXL04_017961|OH1004|cDNA

ATGGAAAACAATGGCGACCACAGAAGCTATTGGGAATCCTTACTGCGAACCGAAGATTTCAACAGTTGGGGCGGATTCGAAGAAACGCTTTCCAGCTACTACGACTCCAGCTCGCCGGACGGTTCTCAGTCGGTGACCACCTCCAAGAACATCATGTCGGAGAGGAACCGGAGGAAGAAGCTCAATGATAGGCTCTTCGCACTCAGAGCGGTGGTCCCTAAGATTAGTAAGATGGATAAGGCGTCAATAATTAAAGATGC...

CDS

Download CDS FASTA

726 bp · LXL04_017961|LXL04_017961|OH1004|CDS

ATGGAAAACAATGGCGACCACAGAAGCTATTGGGAATCCTTACTGCGAACCGAAGATTTCAACAGTTGGGGCGGATTCGAAGAAACGCTTTCCAGCTACTACGACTCCAGCTCGCCGGACGGTTCTCAGTCGGTGACCACCTCCAAGAACATCATGTCGGAGAGGAACCGGAGGAAGAAGCTCAATGATAGGCTCTTCGCACTCAGAGCGGTGGTCCCTAAGATTAGTAAGATGGATAAGGCGTCAATAATTAAAGATGC...

Protein

Download Protein FASTA

241 aa · LXL04_017961|LXL04_017961|OH1004|PROTEIN

MENNGDHRSYWESLLRTEDFNSWGGFEETLSSYYDSSSPDGSQSVTTSKNIMSERNRRKKLNDRLFALRAVVPKISKMDKASIIKDAIEYIQILHDQERTIQAELTELEARKLESGMLDISQETGFMSPESLKKKRLDQAFDPSGSNSYPIEVLELNVSYVGEKTVLVSLKCIKRRDTIVKLCEVFESLKLKIVTANISVLSERLFNTLFIQADEGEMEFLKIQIETAISALSNSQSPMSM

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_017961`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_017961

Location Chr04:4321998-4325046 (-)

Description Similar to BHLH35: Transcription factor bHLH35

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g57150`	Transcription factor bHLH35.	No verified direct reference in this release
`At4g29930`	Transcription factor bHLH27.	No verified direct reference in this release
`At2g16910`	Transcription factor.	No verified direct reference in this release
`At2g28160`	Transcription factor.	The essential basic helix-loop-helix protein FIT1 is required for the iron deficiency response.2004 · DOI: 10.1105/tpc.104.024315 AtbHLH29 of Arabidopsis thaliana is a functional ortholog of tomato FER involved in controlling iron acquisition in strategy I plants.2005 · DOI: 10.1038/sj.cr.7290331

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0301500`	Transcription factor involved in phosphate starvation response.	RERJ1, a jasmonic acid-responsive gene from rice, encodes a basic helix-loop-helix protein.2004 · DOI: 10.1016/j.bbrc.2004.10.126 Stress-induced expression of the transcription factor RERJ1 is tightly regulated in response to jasmonic acid accumulation in rice.2013 · DOI: 10.1007/s00709-012-0400-z OsbHLH6 interacts with OsSPX4 and regulates the phosphate starvation response in rice.2021 · DOI: 10.1111/tpj.15061

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017961 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009555 pollen development Biological Process

GO:0009867 jasmonic acid mediated signaling pathway Biological Process

GO:0010039 response to iron ion Biological Process

GO:0034756 regulation of iron ion transport Biological Process

GO:0048658 anther wall tapetum development Biological Process

GO:0048831 regulation of shoot system development Biological Process

GO:0055062 phosphate ion homeostasis Biological Process

GO:0080040 positive regulation of cellular response to phosphate starvation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT2G16910

ath:AT2G28160

ath:AT4G29930

ath:AT5G57150

dosa:Os04g0301500

osa:4335417

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.953

Rank 1 · LXL04_017961 · OH-1004

Cytoplasm0.134

Rank 2 · LXL04_017961 · OH-1004

Cell membrane0.029

Rank 3 · LXL04_017961 · OH-1004

Endoplasmic reticulum0.015

Rank 4 · LXL04_017961 · OH-1004

Plastid0.010

Rank 5 · LXL04_017961 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00010.32HLH50-94 aa

PF23177.2bHLH_IRO350-109 aa

PF22754.5bHLH-TF_ACT-like_plant155-230 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_017961	`PF00010.32`	HLH	50	94	1.9e-11	44.3
LXL04_017961	`PF23177.2`	bHLH_IRO3	50	109	2.2e-07	31.9
LXL04_017961	`PF22754.5`	bHLH-TF_ACT-like_plant	155	230	3e-22	79.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q2HIV9`	Arabidopsis thaliana	Transcription factor bHLH35	53.814%	Swiss-Prot	strong database homology
`Q700E3`	Arabidopsis thaliana	Transcription factor bHLH27	46.188%	Swiss-Prot	moderate database homology
`Q9ZVX2`	Arabidopsis thaliana	Transcription factor ABORTED MICROSPORES	33.333%	Swiss-Prot	moderate database homology
`Q0V7X4`	Arabidopsis thaliana	Transcription factor FER-LIKE IRON DEFICIENCY-INDUCED TRANSCRIPTION FACTOR	31.720%	Swiss-Prot	moderate database homology
`Q0JEB7`	Oryza sativa subsp. japonica	Transcription factor BHLH6	38.605%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card