TkA07G429560 | RubberDandelionOmics

Gene overview

TkA07G429560

Reference: TK1151 Chr: Chr07 Coordinates: 108718325-108727661 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

360 bp · TkA07G429560|TK1151|cDNA

ATGTCCAAAGCATCTAAGATTTATGATTTACCGATGCCGGATTTTGGGGGTACGACGCTAGGGCTTCGTCAAGAGCAGCGATTGATTCTTATTACGGCTTCGATTTTTGGAAGGAGGAGAAAGGATAACTCGGTTTACCTCGACATGAAAACCAACAGCCACCATCTTCTTCATCATTCGACCTCTGACAGCCAACACCGCCGCAAGCTTCCCTCCGGCAAGTTCTTCCTCTCAACCGTTGTTCTATATATCTCTGTTCT...

CDS

Download CDS FASTA

4386 bp · TkA07G429560|TK1151|CDS

ATGAAAACCAACAGCCACCATCTTCTTCATCATTCGACCTCTGACAGCCAACACCGCCGCAAGCTTCCCTCCGGCAAGTTCTTCCTCTCAACCGTTGTTCTATATATCTCTGTTCTATGGTTGATCTCCATATTGAAGAAACGAAGGCAGATGGTGGTGATGGCGACGGTAATGGAGAGGAAAATGATGATGGTGGGATGTAGTGGCAAGAGTCCACATAGTCAAGTTCTTTCCAGAAGCTCTTGTTCTCGATCGACGAT...

Protein

Download Protein FASTA

1461 aa · TkA07G429560|TK1151|PROTEIN

MKTNSHHLLHHSTSDSQHRRKLPSGKFFLSTVVLYISVLWLISILKKRRQMVVMATVMERKMMMVGCSGKSPHSQVLSRSSCSRSTIAMADDSYENNTTTIRILCRKLLLITKSESGIQWLIGSSFLPTFTVVSTFRCINTLPSDPLSPDFSKESDDMRALLPRGFEVIGSLIAGTTNPNVERSARDAIDASSKMRKALSQLEDRSLIGAVVDPNSGDIRFFVSNSVVELEPVTSAVFEDNPEKYVWERGCILHCELPIK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G429560`
TK1151 ID	TkA07G429560
OH-1004 ID	LXL04_030763
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 100.000 / OH-1004 96.819 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G429560

Location Chr07:108718325-108727661 (+)

Description Similar to MRF1: MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g63190`	Involved in target of rapamycin (TOR)-regulated translation control, especially under energy-deficient conditions.	MRF Family Genes Are Involved in Translation Control, Especially under Energy-Deficient Conditions, and Their Expression and Functions Are Modulated by the TOR Signaling Pathway.2017 · DOI: 10.1105/tpc.17.00563
`At4g24800`	Involved in target of rapamycin (TOR)-regulated translation control, especially under energy-deficient conditions.	EIN2 regulates salt stress response and interacts with a MA3 domain-containing protein ECIP1 in Arabidopsis.2011 · DOI: 10.1111/j.1365-3040.2011.02363.x
`At3g48390`	Involved in target of rapamycin (TOR)-regulated translation control, especially under energy-deficient conditions.	MRF Family Genes Are Involved in Translation Control, Especially under Energy-Deficient Conditions, and Their Expression and Functions Are Modulated by the TOR Signaling Pathway.2017 · DOI: 10.1105/tpc.17.00563
`At3g48380`	Thiol protease which recognizes and hydrolyzes the peptide bond at the C-terminal Gly of UFM1, a ubiquitin-like modifier protein bound to a number of target proteins.	No verified direct reference in this release
`At1g22730`	Involved in target of rapamycin (TOR)-regulated translation control, especially under energy-deficient conditions.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0285500`	Thiol protease which recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ufm-1, a ubiquitin-like modifier protein bound to a number of target proteins.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030763 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006417 regulation of translation Biological Process

GO:0009646 response to absence of light Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0090549 response to carbon starvation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G48390

ath:AT4G24800

ath:AT5G63190

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.458

Rank 1 · TkA07G429560 · TK1151

Nucleus0.369

Rank 2 · TkA07G429560 · TK1151

Cell membrane0.123

Rank 3 · TkA07G429560 · TK1151

Endoplasmic reticulum0.085

Rank 4 · TkA07G429560 · TK1151

Plastid0.085

Rank 5 · TkA07G429560 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20908UfSP2_N401-490 aa

PF07910Peptidase_C78523-713 aa

PF02847MA3880-990 aa

PF25050TARBP1914-972 aa

PF02847MA31043-1154 aa

PF25393LTM1055-1071 aa

PF02847MA31179-1288 aa

PF25393LTM1274-1283 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G429560	`PF20908`	UfSP2_N	401	490	1.6e-07	32.1
TkA07G429560	`PF07910`	Peptidase_C78	523	713	1.1e-65	221.8
TkA07G429560	`PF02847`	MA3	880	990	4e-120	394.7
TkA07G429560	`PF25050`	TARBP1	914	972	0.24	11.4
TkA07G429560	`PF02847`	MA3	1043	1154	4e-120	394.7
TkA07G429560	`PF25393`	LTM	1055	1071	0.24	12.0
TkA07G429560	`PF02847`	MA3	1179	1288	4e-120	394.7
TkA07G429560	`PF25393`	LTM	1274	1283	0.24	12.0
TkA07G429560	`PF02847`	MA3	1342	1449	4e-120	394.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94BR1`	Arabidopsis thaliana	sp\|Q94BR1\|MRF1_ARATH MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 1	71.900%	Swiss-Prot	High
`Q8W4Q4`	Arabidopsis thaliana	sp\|Q8W4Q4\|MRF3_ARATH MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 3	71.900%	Swiss-Prot	High
`Q9STL9`	Arabidopsis thaliana	sp\|Q9STL9\|MRF4_ARATH MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 4	70.100%	Swiss-Prot	High
`Q9STL8`	Arabidopsis thaliana	sp\|Q9STL8\|UFSP_ARATH Probable Ufm1-specific protease	59.700%	Swiss-Prot	High
`O80548`	Arabidopsis thaliana	sp\|O80548\|MRF2_ARATH MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 2	49.100%	Swiss-Prot	Medium
`Q0INW1`	Oryza sativa subsp. japonica	sp\|Q0INW1\|UFSP_ORYSJ Probable Ufm1-specific protease	53.400%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card