LXL04_030763 | RubberDandelionOmics

Gene overview

LXL04_030763

Reference: OH-1004 Chr: Chr06 Coordinates: 122332309-122341501 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4530 bp · LXL04_030763|LXL04_030763|OH1004|cDNA

ATGTCCAAAGCATCTAAGATTTATGATTTACCGATGCCGGATTTTGGGGGTACGACGCTAGGGCTTCGTCAAGAGCAGCGATTGATTCTTATTACGGCTTCGATTTTTGGAAGGAGGAGAAAGGATAACTCGGTTTACCTCGACATGAAAACCAACAGCCACCATCTTCTTCATCATTCGACCTCTGACAGCCAACACCGCCGCAAGCTTCCCTCCGGCAAGTTCTTCCTCTCAACCGTTGTTCTATATATCTCTGTTCT...

CDS

Download CDS FASTA

4530 bp · LXL04_030763|LXL04_030763|OH1004|CDS

ATGTCCAAAGCATCTAAGATTTATGATTTACCGATGCCGGATTTTGGGGGTACGACGCTAGGGCTTCGTCAAGAGCAGCGATTGATTCTTATTACGGCTTCGATTTTTGGAAGGAGGAGAAAGGATAACTCGGTTTACCTCGACATGAAAACCAACAGCCACCATCTTCTTCATCATTCGACCTCTGACAGCCAACACCGCCGCAAGCTTCCCTCCGGCAAGTTCTTCCTCTCAACCGTTGTTCTATATATCTCTGTTCT...

Protein

Download Protein FASTA

1509 aa · LXL04_030763|LXL04_030763|OH1004|PROTEIN

MSKASKIYDLPMPDFGGTTLGLRQEQRLILITASIFGRRRKDNSVYLDMKTNSHHLLHHSTSDSQHRRKLPSGKFFLSTVVLYISVLWLISILKKRRQMVVMATVMERKMMTVGCSGKSPHSQVLSRSSCSRSTIAMADDSYENNTTTIRILCRKLLLITKSESGIQWLIGSSFLPTFTVVSTFRCINTLPSDPLSPDFSKESDDMRALLPRGFEVIGSLIAGTTNPNVERSARDAIDASSKMRKALSQLEDRSLIGAVV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_030763`
TK1151 ID	TkA07G429560
OH-1004 ID	LXL04_030763
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.900
Protein coverage (%)	TK1151 100.000 / OH-1004 96.819 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_030763

Location Chr06:122332309-122341501 (+)

Description Similar to MRF1: MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g63190`	Involved in target of rapamycin (TOR)-regulated translation control, especially under energy-deficient conditions.	MRF Family Genes Are Involved in Translation Control, Especially under Energy-Deficient Conditions, and Their Expression and Functions Are Modulated by the TOR Signaling Pathway.2017 · DOI: 10.1105/tpc.17.00563
`At4g24800`	Involved in target of rapamycin (TOR)-regulated translation control, especially under energy-deficient conditions.	EIN2 regulates salt stress response and interacts with a MA3 domain-containing protein ECIP1 in Arabidopsis.2011 · DOI: 10.1111/j.1365-3040.2011.02363.x
`At3g48390`	Involved in target of rapamycin (TOR)-regulated translation control, especially under energy-deficient conditions.	MRF Family Genes Are Involved in Translation Control, Especially under Energy-Deficient Conditions, and Their Expression and Functions Are Modulated by the TOR Signaling Pathway.2017 · DOI: 10.1105/tpc.17.00563
`At3g48380`	Thiol protease which recognizes and hydrolyzes the peptide bond at the C-terminal Gly of UFM1, a ubiquitin-like modifier protein bound to a number of target proteins.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0285500`	Thiol protease which recognizes and hydrolyzes the peptide bond at the C-terminal Gly of ufm-1, a ubiquitin-like modifier protein bound to a number of target proteins.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030763 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006417 regulation of translation Biological Process

GO:0009646 response to absence of light Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009873 ethylene-activated signaling pathway Biological Process

GO:0045892 negative regulation of DNA-templated transcription Biological Process

GO:0090549 response to carbon starvation Biological Process

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005829 cytosol Cellular Component

GO:0003729 mRNA binding Molecular Function

KEGG gene cross-reference

ath:AT3G48390

ath:AT4G24800

ath:AT5G63190

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.438

Rank 1 · LXL04_030763 · OH-1004

Nucleus0.367

Rank 2 · LXL04_030763 · OH-1004

Cell membrane0.128

Rank 3 · LXL04_030763 · OH-1004

Plastid0.093

Rank 4 · LXL04_030763 · OH-1004

Endoplasmic reticulum0.086

Rank 5 · LXL04_030763 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20908.3UfSP2_N449-538 aa

PF07910.20Peptidase_C78571-761 aa

PF02847.24MA3928-1038 aa

PF02847.24MA31091-1202 aa

PF02847.24MA31227-1336 aa

PF02847.24MA31390-1497 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_030763	`PF20908.3`	UfSP2_N	449	538	1.7e-07	32.1
LXL04_030763	`PF07910.20`	Peptidase_C78	571	761	1.1e-65	221.7
LXL04_030763	`PF02847.24`	MA3	928	1038	2e-120	395.7
LXL04_030763	`PF02847.24`	MA3	1091	1202	2e-120	395.7
LXL04_030763	`PF02847.24`	MA3	1227	1336	2e-120	395.7
LXL04_030763	`PF02847.24`	MA3	1390	1497	2e-120	395.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94BR1`	Arabidopsis thaliana	MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 1	72.700%	Swiss-Prot	weak database homology
`Q8W4Q4`	Arabidopsis thaliana	MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 3	70.972%	Swiss-Prot	weak database homology
`Q9STL9`	Arabidopsis thaliana	MA3 DOMAIN-CONTAINING TRANSLATION REGULATORY FACTOR 4	70.618%	Swiss-Prot	weak database homology
`Q9STL8`	Arabidopsis thaliana	Probable Ufm1-specific protease	59.601%	Swiss-Prot	weak database homology
`Q0INW1`	Oryza sativa subsp. japonica	Probable Ufm1-specific protease	53.239%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card