Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3211 bp · TkA07G144470|TK1151|cDNA
CTGAAGTTGCTCATGTCACAACTGTGTGTTGTGGAGAATATGAATAAACGGTTAGTTTTCCGAAGGCGGTCGTCTATGAACCCTAATCCAAATGTTCATGAAAATGGAACGAGTTCAGCTAAAGTTGCACTTTGGTTTGTAACAAGTGTGTTTGGATAGGATGTACAGACGACTAGTTGTGACAGCAGTGGAAGGCGGTCGCCTCTCTCTCATATAAACCCTACATCCTATATACCCAGAACCCTAAAAAATCTAATACC...
2787 bp · TkA07G144470|TK1151|CDS
ATGCCATACGATGAAGAGGAATCCTCCGGCAGCGACTCCGATGCCGGATTTGACGAAGACATGGAAGCCCTAAGAAAGGCCTGCTCTGTCATAGGTGTGGACGATTCTGTCGATGATCTCCCGAAACCATCGACCGCCTATAGCGATTATGACGACACCTACACGTCTGAGGATGAAGACATAGAACTGCTGCGTAACATCCAGCAACGTTTTTCTGTTCCCACCAACGACGTTGGCAGTGAACACCATTCTATTTCTAT...
Protein
Download Protein FASTA928 aa · TkA07G144470|TK1151|PROTEIN
MPYDEEESSGSDSDAGFDEDMEALRKACSVIGVDDSVDDLPKPSTAYSDYDDTYTSEDEDIELLRNIQQRFSVPTNDVGSEHHSISMKPLSIIMPSGLSDDNDDYGDDFETLRAIQRRFSQYYDSKNKDKESSVQKPEQVGATNIELEKETSTSPNFFVKSINNGQGFPDCVDGRATNRKLDLSSNSTPDTHEPGSEIIPAPDCGFPRSAQAFVEPIKKNRICQKFIRNKIGQIEAKMEENKKLRERVKILKDFQVACRK...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G144470 |
|---|---|
| TK1151 ID | TkA07G144470 |
| OH-1004 ID | LXL04_028329 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 93.200 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 47.301Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G144470 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:37301008-37316745 (+) | |||||||||
| Description | Similar to mybL: Myb-like protein L | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0042795 snRNA transcription by RNA polymerase II Biological Process GO:0042796 snRNA transcription by RNA polymerase III Biological Process GO:0005634 nucleus Cellular Component GO:0005654 nucleoplasm Cellular Component GO:0019185 snRNA-activating protein complex Cellular Component GO:0000995 RNA polymerase III general transcription initiation factor activity Molecular Function GO:0001006 RNA polymerase III type 3 promoter sequence-specific DNA binding Molecular Function GO:0003677 DNA binding Molecular Function GO:0016251 RNA polymerase II general transcription initiation factor activity Molecular Function | |||||||||
| KEGG gene cross-reference | ddi:DDB_G0285373 hsa:6621 mmu:227644 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13921Myb_DNA-bind_658-72 aaPF00249Myb_DNA-binding321-338 aaPF15963Myb_DNA-bind_7321-338 aaPF13921Myb_DNA-bind_6324-426 aaPF23588HTH_CHD1_Hrp3324-338 aaPF00249Myb_DNA-binding384-407 aaPF00249Myb_DNA-binding417-460 aaPF23588HTH_CHD1_Hrp3417-442 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G144470 | PF13921 | Myb_DNA-bind_6 | 58 | 72 | 2.6e-50 | 169.2 |
| TkA07G144470 | PF00249 | Myb_DNA-binding | 321 | 338 | 2.6e-59 | 197.8 |
| TkA07G144470 | PF15963 | Myb_DNA-bind_7 | 321 | 338 | 0.054 | 14.0 |
| TkA07G144470 | PF13921 | Myb_DNA-bind_6 | 324 | 426 | 2.6e-50 | 169.2 |
| TkA07G144470 | PF23588 | HTH_CHD1_Hrp3 | 324 | 338 | 1.3e-08 | 35.4 |
| TkA07G144470 | PF00249 | Myb_DNA-binding | 384 | 407 | 2.6e-59 | 197.8 |
| TkA07G144470 | PF00249 | Myb_DNA-binding | 417 | 460 | 2.6e-59 | 197.8 |
| TkA07G144470 | PF23588 | HTH_CHD1_Hrp3 | 417 | 442 | 1.3e-08 | 35.4 |
| TkA07G144470 | PF13921 | Myb_DNA-bind_6 | 418 | 472 | 2.6e-50 | 169.2 |
| TkA07G144470 | PF23588 | HTH_CHD1_Hrp3 | 461 | 494 | 1.3e-08 | 35.4 |
| TkA07G144470 | PF00249 | Myb_DNA-binding | 468 | 512 | 2.6e-59 | 197.8 |
| TkA07G144470 | PF15963 | Myb_DNA-bind_7 | 468 | 514 | 0.054 | 14.0 |
| TkA07G144470 | PF13921 | Myb_DNA-bind_6 | 471 | 520 | 2.6e-50 | 169.2 |
| TkA07G144470 | PF15963 | Myb_DNA-bind_7 | 518 | 563 | 0.054 | 14.0 |
| TkA07G144470 | PF00249 | Myb_DNA-binding | 522 | 567 | 2.6e-59 | 197.8 |
| TkA07G144470 | PF23588 | HTH_CHD1_Hrp3 | 523 | 547 | 1.3e-08 | 35.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.