LXL04_028329 | RubberDandelionOmics

Gene overview

LXL04_028329

Reference: OH-1004 Chr: Chr06 Coordinates: 38169241-38184839 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5895 bp · LXL04_028329|LXL04_028329|OH1004|cDNA

atggtcaactccgtgatggtgggatTCCAGAAGTTTATACGTAACAAAATAGGGCAAATTGAAGCAAAGATggaagaaaataaaaaattaaggGAGCGTGTTAAAATCCTGAAAGACTTTCAGGTGGCTTGTAGGAAAAAAACAGGCAGGGCATTGTCTCAGAAAAAGGATCCACGCACCCAACTTATTTCAGTTCCAAAGCAGAGAGCCAATGCGGCTAAGGATAAAGAAATGCATGCAATTAATCAAGGGCCTGCTGA...

CDS

Download CDS FASTA

5895 bp · LXL04_028329|LXL04_028329|OH1004|CDS

ATGGTCAACTCCGTGATGGTGGGATTCCAGAAGTTTATACGTAACAAAATAGGGCAAATTGAAGCAAAGATGGAAGAAAATAAAAAATTAAGGGAGCGTGTTAAAATCCTGAAAGACTTTCAGGTGGCTTGTAGGAAAAAAACAGGCAGGGCATTGTCTCAGAAAAAGGATCCACGCACCCAACTTATTTCAGTTCCAAAGCAGAGAGCCAATGCGGCTAAGGATAAAGAAATGCATGCAATTAATCAAGGGCCTGCTGA...

Protein

Download Protein FASTA

1964 aa · LXL04_028329|LXL04_028329|OH1004|PROTEIN

MVNSVMVGFQKFIRNKIGQIEAKMEENKKLRERVKILKDFQVACRKKTGRALSQKKDPRTQLISVPKQRANAAKDKEMHAINQGPAENSHVADYRDAMSNYPFALTREPWSKEENENLLKGVKQQFQEMLMQNILSSEDADWHDVDTMLTQIKHHEISPEEMRAFLPKVNWDHLASMYVTSRTGPECKSRWMNSEDPLINFDSWTVTEDKKLLYTVQNLGLCNWAHISDALGTNRTPFQSLSRFQRSLNASIIKNEWTPP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028329`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028329

Location Chr06:38169241-38184839 (+)

Description Similar to mybL: Myb-like protein L

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g09370`	Transcription factor that binds 5'-AACGG-3' motifs in gene promoters (By similarity).	Transcriptional repression by MYB3R proteins regulates plant organ growth.2015 · DOI: 10.15252/embj.201490899

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028329 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0042795 snRNA transcription by RNA polymerase II Biological Process

GO:0042796 snRNA transcription by RNA polymerase III Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0019185 snRNA-activating protein complex Cellular Component

GO:0000995 RNA polymerase III general transcription initiation factor activity Molecular Function

GO:0001006 RNA polymerase III type 3 promoter sequence-specific DNA binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0016251 RNA polymerase II general transcription initiation factor activity Molecular Function

KEGG gene cross-reference

ddi:DDB_G0285373

hsa:6621

mmu:227644

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.959

Rank 1 · LXL04_028329 · OH-1004

Cytoplasm0.073

Rank 2 · LXL04_028329 · OH-1004

Cell membrane0.028

Rank 3 · LXL04_028329 · OH-1004

Plastid0.014

Rank 4 · LXL04_028329 · OH-1004

Endoplasmic reticulum0.013

Rank 5 · LXL04_028329 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13921.13Myb_DNA-bind_6110-212 aa

PF00249.38Myb_DNA-binding203-246 aa

PF13921.13Myb_DNA-bind_6204-259 aa

PF00249.38Myb_DNA-binding254-298 aa

PF13921.13Myb_DNA-bind_6257-306 aa

PF00249.38Myb_DNA-binding308-353 aa

PF13921.13Myb_DNA-bind_6310-367 aa

PF00249.38Myb_DNA-binding360-402 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028329	`PF13921.13`	Myb_DNA-bind_6	110	212	6e-97	318.5
LXL04_028329	`PF00249.38`	Myb_DNA-binding	203	246	3.2e-114	373.6
LXL04_028329	`PF13921.13`	Myb_DNA-bind_6	204	259	6e-97	318.5
LXL04_028329	`PF00249.38`	Myb_DNA-binding	254	298	3.2e-114	373.6
LXL04_028329	`PF13921.13`	Myb_DNA-bind_6	257	306	6e-97	318.5
LXL04_028329	`PF00249.38`	Myb_DNA-binding	308	353	3.2e-114	373.6
LXL04_028329	`PF13921.13`	Myb_DNA-bind_6	310	367	6e-97	318.5
LXL04_028329	`PF00249.38`	Myb_DNA-binding	360	402	3.2e-114	373.6
LXL04_028329	`PF13921.13`	Myb_DNA-bind_6	362	407	6e-97	318.5
LXL04_028329	`PF13921.13`	Myb_DNA-bind_6	1359	1461	6e-97	318.5
LXL04_028329	`PF00249.38`	Myb_DNA-binding	1452	1495	3.2e-114	373.6
LXL04_028329	`PF13921.13`	Myb_DNA-bind_6	1453	1508	6e-97	318.5
LXL04_028329	`PF00249.38`	Myb_DNA-binding	1503	1547	3.2e-114	373.6
LXL04_028329	`PF13921.13`	Myb_DNA-bind_6	1506	1555	6e-97	318.5
LXL04_028329	`PF00249.38`	Myb_DNA-binding	1557	1602	3.2e-114	373.6
LXL04_028329	`PF13921.13`	Myb_DNA-bind_6	1559	1616	6e-97	318.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8H1P9`	Arabidopsis thaliana	Transcription factor MYB3R-3	39.735%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card