RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G131370
Reference: TK1151 Chr: Chr07 Coordinates: 33958235-33960995 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1656 bp · TkA07G131370|TK1151|cDNA

CTGAATTGGACATGTAAGAAACCACTGATTGAAGTGTCCATATTTAGCTCAGTACTTCTGAAACGACTTTTCTTCCCTTAACAAAGACCAAACACTGGGAACAAAATCATCAAAATTTTCATCAAAACTCACTTCTTCACACTCCAGTTCTGCAGATTCACCCATGGATGACGATAGTGATCGGAGTTCAGAAGCAACTGAATTGGAAAATTTTACAGTAGAAAGAAGGAGGCACGGTCACAACGACAACGCTGAAGATT...

CDS

Download CDS FASTA

1224 bp · TkA07G131370|TK1151|CDS

ATGGATGACGATAGTGATCGGAGTTCAGAAGCAACTGAATTGGAAAATTTTACAGTAGAAAGAAGGAGGCACGGTCACAACGACAACGCTGAAGATTCCGGCACCCTAAATGAAGATGAATTCGATGACGATGAGACTGATGATCAGAGAGAGGTTAGTAATTTAGGGACTTCACCTATGGAAATCGACGCATATTCAAGAACTTGTCAATCTGAAACCCTAGTATCTGGCTTGGCGGAGGTCCCGATACAGTATGAGAT...

Protein

Download Protein FASTA

407 aa · TkA07G131370|TK1151|PROTEIN

MDDDSDRSSEATELENFTVERRRHGHNDNAEDSGTLNEDEFDDDETDDQREVSNLGTSPMEIDAYSRTCQSETLVSGLAEVPIQYEMRQEELEHLKNQFQGSHQEALAIVIAKAAESQSGSKIQLPIIPSLPSESSPISSIPKLNPQGEILLIEGKSDHKTVSTSRTVKTPIDGYNWRKYGQKQVKIPEGSRSYYKCTHNECEAKKIESCDQYNSITKIVYKGQHKHEQPKKVFTRRGKILSSSKGQDCNFSSNSMHCKS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G131370
TK1151 IDTkA07G131370
OH-1004 IDLXL04_028215
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.000
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G131370
LocationChr07:33958235-33960995 (+)
DescriptionSimilar to WRKY32: Probable WRKY transcription factor 32
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g30935 Transcription factor. No verified direct reference in this release
At2g03340 Transcription factor. No verified direct reference in this release
At1g13960 Transcription factor that binds specifically to the W box (5'-(T)TGAC[CT]-3'), a frequently occurring elicitor-responsive cis- acting element.
Roles of Arabidopsis WRKY3 and WRKY4 transcription factors in plant responses to pathogens.2008 · DOI: 10.1186/1471-2229-8-68
Structural basis for sequence-specific DNA recognition by an Arabidopsis WRKY transcription factor.2012 · DOI: 10.1074/jbc.m111.279844
At2g38470 Transcription factor.
Functional characterization of Arabidopsis NaCl-inducible WRKY25 and WRKY33 transcription factors in abiotic stresses.2009 · DOI: 10.1007/s11103-008-9408-3
Arabidopsis thaliana WRKY25, WRKY26, and WRKY33 coordinate induction of plant thermotolerance.2011 · DOI: 10.1007/s00425-011-1375-2
Phosphorylation of a WRKY transcription factor by two pathogen-responsive MAPKs drives phytoalexin biosynthesis in Arabidopsis.2011 · DOI: 10.1105/tpc.111.084996
Arabidopsis sigma factor binding proteins are activators of the WRKY33 transcription factor in plant defense.2011 · DOI: 10.1105/tpc.111.090571
Arabidopsis WRKY33 is a key transcriptional regulator of hormonal and metabolic responses toward Botrytis cinerea infection.2012 · DOI: 10.1104/pp.111.192641

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_028215 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006351 DNA-templated transcription Biological Process
GO:0006355 regulation of DNA-templated transcription Biological Process
GO:0006952 defense response Biological Process
GO:0009651 response to salt stress Biological Process
GO:0009723 response to ethylene Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0009751 response to salicylic acid Biological Process
GO:0009753 response to jasmonic acid Biological Process
GO:1900150 regulation of defense response to fungus Biological Process
GO:1900425 negative regulation of defense response to bacterium Biological Process
GO:0005634 nucleus Cellular Component
GO:0000976 transcription cis-regulatory region binding Molecular Function
KEGG gene cross-reference
ath:AT1G13960
ath:AT4G30935
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.946
Rank 1 · TkA07G131370 · TK1151
Cytoplasm0.182
Rank 2 · TkA07G131370 · TK1151
Mitochondrion0.021
Rank 3 · TkA07G131370 · TK1151
Cell membrane0.017
Rank 4 · TkA07G131370 · TK1151
Golgi apparatus0.007
Rank 5 · TkA07G131370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08020DUF170683-110 aa
PF08020DUF1706165-190 aa
PF03106WRKY173-228 aa
PF23549Zn_ribbon_GRF_2191-203 aa
PF08020DUF1706311-325 aa
PF03106WRKY316-372 aa
PF23549Zn_ribbon_GRF_2335-343 aa
PF23549Zn_ribbon_GRF_2381-396 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G131370PF08020DUF1706831100.1512.7
TkA07G131370PF08020DUF17061651900.1512.7
TkA07G131370PF03106WRKY1732282.2e-43147.0
TkA07G131370PF23549Zn_ribbon_GRF_21912032.38.8
TkA07G131370PF08020DUF17063113250.1512.7
TkA07G131370PF03106WRKY3163722.2e-43147.0
TkA07G131370PF23549Zn_ribbon_GRF_23353432.38.8
TkA07G131370PF23549Zn_ribbon_GRF_23813962.38.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
P59583Arabidopsis thalianasp|P59583|WRK32_ARATH Probable WRKY transcription factor 3249.400%Swiss-ProtMedium
Q9ZQ70Arabidopsis thalianasp|Q9ZQ70|WRKY3_ARATH Probable WRKY transcription factor 339.000%Swiss-ProtMedium
Q9XI90Arabidopsis thalianasp|Q9XI90|WRKY4_ARATH Probable WRKY transcription factor 435.500%Swiss-ProtMedium
Q8S8P5Arabidopsis thalianasp|Q8S8P5|WRK33_ARATH Probable WRKY transcription factor 3340.400%Swiss-ProtMedium

JBrowse

View in Genome Browser