LXL04_028215 | RubberDandelionOmics

Gene overview

LXL04_028215

Reference: OH-1004 Chr: Chr06 Coordinates: 34845751-34848075 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1224 bp · LXL04_028215|LXL04_028215|OH1004|cDNA

ATGGATGACGATAGTGATCGGAGTTCAGAAGCAACTGAATTGGAAAATTTTACAGTAGAAAGAAGGAGGCACGGTCACAACGACAACGCTGAAGATTCCGGCACCCTAAATGAAGATGAATTCGATGACGATGAGACTGATGATCAGAGAGAGGTTAGTAATTTAGGGACTTCACCTATGGAAATCGACGCATATTCAAGAACTTGTCAATCTGAAACCCTAGTATCTGGCTTGGCGGAGGTCCCGATACAGTATGAGAT...

CDS

Download CDS FASTA

1224 bp · LXL04_028215|LXL04_028215|OH1004|CDS

ATGGATGACGATAGTGATCGGAGTTCAGAAGCAACTGAATTGGAAAATTTTACAGTAGAAAGAAGGAGGCACGGTCACAACGACAACGCTGAAGATTCCGGCACCCTAAATGAAGATGAATTCGATGACGATGAGACTGATGATCAGAGAGAGGTTAGTAATTTAGGGACTTCACCTATGGAAATCGACGCATATTCAAGAACTTGTCAATCTGAAACCCTAGTATCTGGCTTGGCGGAGGTCCCGATACAGTATGAGAT...

Protein

Download Protein FASTA

407 aa · LXL04_028215|LXL04_028215|OH1004|PROTEIN

MDDDSDRSSEATELENFTVERRRHGHNDNAEDSGTLNEDEFDDDETDDQREVSNLGTSPMEIDAYSRTCQSETLVSGLAEVPIQYEMRQEELEHLKNQFQGSHQEALAIVIAKAAESQSGSKIQLPIIPSLPSESSPISSIPKLNPQGEILLIEGKSDHKTVSTSRTVKTPIDGYNWRKYGQKQVKIPEGSRSYYKCTHNECEAKKIESCDQYNSITKIVYKGQHKHEQPKKVFTRRGKILSSSKGQDCNFSSNSMHCKS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_028215`
TK1151 ID	TkA07G131370
OH-1004 ID	LXL04_028215
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_028215

Location Chr06:34845751-34848075 (+)

Description Similar to WRKY32: Probable WRKY transcription factor 32

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g30935`	Transcription factor.	No verified direct reference in this release
`At1g13960`	Transcription factor that binds specifically to the W box (5'-(T)TGAC[CT]-3'), a frequently occurring elicitor-responsive cis- acting element.	Roles of Arabidopsis WRKY3 and WRKY4 transcription factors in plant responses to pathogens.2008 · DOI: 10.1186/1471-2229-8-68 Structural basis for sequence-specific DNA recognition by an Arabidopsis WRKY transcription factor.2012 · DOI: 10.1074/jbc.m111.279844
`At2g03340`	Transcription factor.	No verified direct reference in this release
`At4g26640`	Transcription factor.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028215 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006952 defense response Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009723 response to ethylene Biological Process

GO:0009737 response to abscisic acid Biological Process

GO:0009751 response to salicylic acid Biological Process

GO:0009753 response to jasmonic acid Biological Process

GO:1900150 regulation of defense response to fungus Biological Process

GO:1900425 negative regulation of defense response to bacterium Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

KEGG gene cross-reference

ath:AT1G13960

ath:AT4G30935

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.946

Rank 1 · LXL04_028215 · OH-1004

Cytoplasm0.181

Rank 2 · LXL04_028215 · OH-1004

Mitochondrion0.021

Rank 3 · LXL04_028215 · OH-1004

Cell membrane0.017

Rank 4 · LXL04_028215 · OH-1004

Golgi apparatus0.007

Rank 5 · LXL04_028215 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03106.22WRKY173-228 aa

PF03106.22WRKY316-372 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_028215	`PF03106.22`	WRKY	173	228	2.2e-43	147.0
LXL04_028215	`PF03106.22`	WRKY	316	372	2.2e-43	147.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P59583`	Arabidopsis thaliana	Probable WRKY transcription factor 32	41.429%	Swiss-Prot	moderate database homology
`Q9XI90`	Arabidopsis thaliana	Probable WRKY transcription factor 4	36.760%	Swiss-Prot	moderate database homology
`Q9ZQ70`	Arabidopsis thaliana	Probable WRKY transcription factor 3	35.671%	Swiss-Prot	moderate database homology
`Q93WV0`	Arabidopsis thaliana	Probable WRKY transcription factor 20	42.544%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card