TkA07G081590 | RubberDandelionOmics

Gene overview

TkA07G081590

Reference: TK1151 Chr: Chr07 Coordinates: 21332658-21340104 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4031 bp · TkA07G081590|TK1151|cDNA

CGCATTTTGGATGAGGGATTTTAGATTTTGGATAGTTTCTTGACGATAGAGATAAATGATTGTGACGGATGGTTTTGTGATTCCTTCCATTATTATCTCGGAATCTTCCTTTTTTTCGTTTGTTAAGAAATTACACTGTTTTTGCTGAAGTCAATCCCGATTAATGACCGTTTTATGCTAATGAAGAGGAAATTGAAATCAAGAACCGGGATTAAGAAGATGAAGATAGTGGCAAATGACATCAATATGTGGGGACTCGA...

CDS

Download CDS FASTA

933 bp · TkA07G081590|TK1151|CDS

ATGAGAACGCTTGTTGTTCTGAATGGAATGCCGCCATGGAAGAGCTCTCCGGTCGCGCGCGGAGACATGAAGTTATCGGAAAAATGCTCCCCGGTGAGGTTTTTGGGGGTTTATGCCGCCTCAAAGATGAAGATACAACTGATGAAATTCACCATTTCGTTGTATAGAGCAATCAATGGTCAAGATACTTCCGATCTGCCATTTGGGTTTTTTGGAAAAGACGGGAAACTTGTGGAGGTTTTCTTGACGGCAAATAAAAG...

Protein

Download Protein FASTA

310 aa · TkA07G081590|TK1151|PROTEIN

MRTLVVLNGMPPWKSSPVARGDMKLSEKCSPVRFLGVYAASKMKIQLMKFTISLYRAINGQDTSDLPFGFFGKDGKLVEVFLTANKRVGECGKVVGCFFFLQTSPRVSIGPEVGEFVLERDSLAYIKQEIKNPLNGLLFTHKLLENSGVSNDQKQYLETSGACERQIASIIDDMDVKSIEEGSMELNMDQFVMENLLDAIVSQVMIVLKEKNIPLVHEIPDQVKKLGLIGDQIRLQMVLSDFLLSIVHHAPSKDGWVEIK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G081590`
TK1151 ID	TkA07G081590
OH-1004 ID	LXL04_032340
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	46.300
Protein coverage (%)	TK1151 80.968 / OH-1004 22.155 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G081590

Location Chr07:21332658-21340104 (-)

Description Similar to PHYB: Phytochrome B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18130`	Regulatory photoreceptor which exists in two forms that are reversibly interconvertible by light: the Pr form that absorbs maximally in the red region of the spectrum and the Pfr form that absorbs maximally in the far-red region.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032340 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006325 chromatin organization Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009266 response to temperature stimulus Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009584 detection of visible light Biological Process

GO:0009585 red, far-red light phototransduction Biological Process

GO:0009630 gravitropism Biological Process

GO:0009638 phototropism Biological Process

GO:0009640 photomorphogenesis Biological Process

KEGG gene cross-reference

ath:AT2G18790

gmx:100794865

sly:101262847

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.405

Rank 1 · TkA07G081590 · TK1151

Nucleus0.321

Rank 2 · TkA07G081590 · TK1151

Mitochondrion0.164

Rank 3 · TkA07G081590 · TK1151

Cell membrane0.070

Rank 4 · TkA07G081590 · TK1151

Endoplasmic reticulum0.064

Rank 5 · TkA07G081590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00512HisKA120-182 aa

PF04345Chor_lyase150-216 aa

PF02518HATPase_c230-298 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G081590	`PF00512`	HisKA	120	182	6.6e-12	46.0
TkA07G081590	`PF04345`	Chor_lyase	150	216	0.28	11.6
TkA07G081590	`PF02518`	HATPase_c	230	298	0.0002	22.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P42498`	Arabidopsis thaliana	sp\|P42498\|PHYE_ARATH Phytochrome E	47.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card