LXL04_032340 | RubberDandelionOmics

Gene overview

LXL04_032340

Reference: OH-1004 Chr: Chr07 Coordinates: 20992328-20997283 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3489 bp · LXL04_032340|LXL04_032340|OH1004|cDNA

ATGCAACCAAATTTAACTTTAAACCAACACCCCAAATCCACCACAAGTATTTATAAACCTCATCACTCCCTGCGTGTAATCTTTCATCCCCAATTCCGAATTCACTCAAGATTTATAGCCATGGCTTCTGGGAGCAAAGCAAGTTCTGGGTTTAATCCACAATCTCAAAACCCTCCGTCATCATCAACGCCTAGGGTTGATTCAATGAGCAAAGCCATTGCACAATACGCAGTTGATGCTAGATTACACGCTGTTTATGA...

CDS

Download CDS FASTA

3483 bp · LXL04_032340|LXL04_032340|OH1004|CDS

ATGCAACCAAATTTAACTTTAAACCAACACCCCAAATCCACCACAAGTATTTATAAACCTCATCACTCCCTGCGTGTAATCTTTCATCCCCAATTCCGAATTCACTCAAGATTTATAGCCATGGCTTCTGGGAGCAAAGCAAGTTCTGGGTTTAATCCACAATCTCAAAACCCTCCGTCATCATCAACGCCTAGGGTTGATTCAATGAGCAAAGCCATTGCACAATACGCAGTTGATGCTAGATTACACGCTGTTTATGA...

Protein

Download Protein FASTA

1160 aa · LXL04_032340|LXL04_032340|OH1004|PROTEIN

MQPNLTLNQHPKSTTSIYKPHHSLRVIFHPQFRIHSRFIAMASGSKASSGFNPQSQNPPSSSTPRVDSMSKAIAQYAVDARLHAVYEQSGESGKSFDYSQSIKTATDSIAEQQMTAYLSKIQRGGHIQPFGCMIAIDNSSFRVIAFSENARERLGLAPQSVPSLERPEILTIGTDVKTLFTPSSAVLLERAFRAREITLLNPVWVHSKNSGKPFYAILHRIDVGIVIDLEPARTEDPALSIAGAVQSQKLAVRAISNLQS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_032340`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_032340

Location Chr07:20992328-20997283 (-)

Description Similar to PHYB: Phytochrome B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g18790`	Regulatory photoreceptor which exists in two forms that are reversibly interconvertible by light: the Pr form that absorbs maximally in the red region of the spectrum and the Pfr form that absorbs maximally in the far-red region.	The out of phase 1 mutant defines a role for PHYB in circadian phase control in Arabidopsis.2002 · DOI: 10.1104/pp.003418 Phytochromes function as thermosensors in Arabidopsis.2016 · DOI: 10.1126/science.aaf6005 Daytime temperature is sensed by phytochrome B in Arabidopsis through a transcriptional activator HEMERA.2019 · DOI: 10.1038/s41467-018-08059-z PHYTOCHROME INTERACTING FACTOR8 Inhibits Phytochrome A-Mediated Far-Red Light Responses in Arabidopsis.2020 · DOI: 10.1105/tpc.19.00515

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_032340 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006325 chromatin organization Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009266 response to temperature stimulus Biological Process

GO:0009408 response to heat Biological Process

GO:0009409 response to cold Biological Process

GO:0009416 response to light stimulus Biological Process

GO:0009584 detection of visible light Biological Process

GO:0009585 red, far-red light phototransduction Biological Process

GO:0009630 gravitropism Biological Process

GO:0009638 phototropism Biological Process

GO:0009640 photomorphogenesis Biological Process

KEGG gene cross-reference

ath:AT2G18790

gmx:100794865

sly:101262847

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.393

Rank 1 · LXL04_032340 · OH-1004

Cytoplasm0.205

Rank 2 · LXL04_032340 · OH-1004

Mitochondrion0.147

Rank 3 · LXL04_032340 · OH-1004

Nucleus0.133

Rank 4 · LXL04_032340 · OH-1004

Cell membrane0.102

Rank 5 · LXL04_032340 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08446.18PAS_2116-232 aa

PF01590.33GAF266-443 aa

PF00360.27PHY456-631 aa

PF00989.32PAS661-776 aa

PF08448.17PAS_4669-780 aa

PF00989.32PAS792-911 aa

PF00512.32HisKA935-997 aa

PF02518.32HATPase_c1045-1156 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_032340	`PF08446.18`	PAS_2	116	232	9.7e-38	129.9
LXL04_032340	`PF01590.33`	GAF	266	443	3.5e-17	63.9
LXL04_032340	`PF00360.27`	PHY	456	631	3.9e-57	193.3
LXL04_032340	`PF00989.32`	PAS	661	776	7.3e-47	158.8
LXL04_032340	`PF08448.17`	PAS_4	669	780	3e-10	41.0
LXL04_032340	`PF00989.32`	PAS	792	911	7.3e-47	158.8
LXL04_032340	`PF00512.32`	HisKA	935	997	1.5e-15	57.7
LXL04_032340	`PF02518.32`	HATPase_c	1045	1156	4.3e-16	60.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P14713`	Arabidopsis thaliana	Phytochrome B	76.958%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card