TkA05G465970 | RubberDandelionOmics

Gene overview

TkA05G465970

Reference: TK1151 Chr: Chr05 Coordinates: 116820865-116823801 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2203 bp · TkA05G465970|TK1151|cDNA

TCACCAACCTATGATTTAGTCTATCTTTTTTTTATATTGCTTATAATACAACATAAGTAAAACATAAAAAATTCAAAAATACAGATTTAACAAAGGTGACACAAACTGTAAGAATACAGTTGTGGCACTTATTTGATTGGTGGGCATTGCATTGGATCCCATGTTTACCTCACTTCCAGAAAAACTGTTAAAAATTTGTACGAGTAATATTTTGGGTCCTCCAACATTTTTAATTTTAGTTGTTTAAAGCTTCTACTGAC...

CDS

Download CDS FASTA

1710 bp · TkA05G465970|TK1151|CDS

ATGGAAAACCCATCTCAAACCTTCAACTTTTTCTTTCGAAATTTAACTTCAAGTGAAATGAGGAGCTCGAGAGCTGTTGTCTTTCTTTTATTTTGCTTGTTTTTTCCATGTGTGTTGAGTGGTGATAGAGAAGCACTTCTGGAACTGAAATCATCCATGGATACTTCCAGTTCTTTACAATGGAGAGGAAGTGATTTCTGCAAATGGGAAGGAGTTCGAGAATGCTTGAGAGGTCGAGTCTCGAAACTTGTTCTTGAAAA...

Protein

Download Protein FASTA

570 aa · TkA05G465970|TK1151|PROTEIN

MENPSQTFNFFFRNLTSSEMRSSRAVVFLLFCLFFPCVLSGDREALLELKSSMDTSSSLQWRGSDFCKWEGVRECLRGRVSKLVLENLNLTGTLDSRIVNQLDQIRVLSLKQNSISGQIPDLSGLANLKSLYLSHNNFSGEFPASLTTLHRLKIIVLSSNRLSGTIPDSLLDLQRLYVFHVDDNNFTGKIPPFSQTTLTYLNLSNNQLSGEIPMTRTLLRFNSTSFTGNIDLCSNSFSIPCGFAPSPSFTPAYPTATNGT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G465970`
TK1151 ID	TkA05G465970
OH-1004 ID	LXL04_022429
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	90.200
Protein coverage (%)	TK1151 99.474 / OH-1004 84.195 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G465970

Location Chr05:116820865-116823801 (-)

Description Similar to At1g60630: Inactive leucine-rich repeat receptor-like serine/threonine-protein kinase At1g60630

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g60630`	Inactive leucine-rich repeat receptor-like serine/threonine-protein kinase At1g60630.	No verified direct reference in this release
`At5g67200`	Probable inactive receptor kinase At5g67200.	No verified direct reference in this release
`At2g26730`	Probable inactive receptor kinase At2g26730.	No verified direct reference in this release
`At5g35390`	Receptor-like kinase involved in the control of pollen germination and pollen tube polar growth.	AtPRK2 promotes ROP1 activation via RopGEFs in the control of polarized pollen tube growth.2013 · DOI: 10.1093/mp/sss103
`At3g08680`	Probable inactive receptor kinase At3g08680.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022429 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005777 peroxisome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009898 cytoplasmic side of plasma membrane Cellular Component

GO:0016328 lateral plasma membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G60630

ath:AT1G68400

ath:AT2G26730

ath:AT5G58300

ath:AT5G67200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.877

Rank 1 · TkA05G465970 · TK1151

Endoplasmic reticulum0.086

Rank 2 · TkA05G465970 · TK1151

Cytoplasm0.071

Rank 3 · TkA05G465970 · TK1151

Nucleus0.050

Rank 4 · TkA05G465970 · TK1151

Lysosome / Vacuole0.022

Rank 5 · TkA05G465970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF20237DUF659422-40 aa

PF08263LRRNT_240-72 aa

PF13855LRR_880-138 aa

PF00560LRR_183-94 aa

PF12799LRR_485-92 aa

PF23598LRR_1485-185 aa

PF24141LRR_ComC104-213 aa

PF00560LRR_1105-121 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G465970	`PF20237`	DUF6594	22	40	0.32	11.6
TkA05G465970	`PF08263`	LRRNT_2	40	72	2.1e-07	31.8
TkA05G465970	`PF13855`	LRR_8	80	138	4.5e-09	36.6
TkA05G465970	`PF00560`	LRR_1	83	94	2.4e-13	48.1
TkA05G465970	`PF12799`	LRR_4	85	92	1.3e-10	41.9
TkA05G465970	`PF23598`	LRR_14	85	185	4e-05	23.2
TkA05G465970	`PF24141`	LRR_ComC	104	213	0.001	19.5
TkA05G465970	`PF00560`	LRR_1	105	121	2.4e-13	48.1
TkA05G465970	`PF12799`	LRR_4	105	141	1.3e-10	41.9
TkA05G465970	`PF13516`	LRR_6	106	116	0.00095	19.8
TkA05G465970	`PF13516`	LRR_6	126	141	0.00095	19.8
TkA05G465970	`PF00560`	LRR_1	127	149	2.4e-13	48.1
TkA05G465970	`PF13855`	LRR_8	127	186	4.5e-09	36.6
TkA05G465970	`PF07723`	LRR_2	127	141	0.093	14.1
TkA05G465970	`PF12799`	LRR_4	151	193	1.3e-10	41.9
TkA05G465970	`PF07723`	LRR_2	151	164	0.093	14.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84MA9`	Arabidopsis thaliana	sp\|Q84MA9\|Y1063_ARATH Inactive leucine-rich repeat receptor-like serine/threonine-protein kinase At1g60630	58.700%	Swiss-Prot	High
`Q93Y06`	Arabidopsis thaliana	sp\|Q93Y06\|Y5720_ARATH Probable inactive receptor kinase At5g67200	48.100%	Swiss-Prot	Medium
`O48788`	Arabidopsis thaliana	sp\|O48788\|Y2267_ARATH Probable inactive receptor kinase At2g26730	40.300%	Swiss-Prot	Medium
`C0LGU0`	Arabidopsis thaliana	sp\|C0LGU0\|PRK1_ARATH Pollen receptor-like kinase 1	36.800%	Swiss-Prot	Medium
`Q9C9Y8`	Arabidopsis thaliana	sp\|Q9C9Y8\|Y3868_ARATH Probable inactive receptor kinase At3g08680	37.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card