LXL04_022429 | RubberDandelionOmics

Gene overview

LXL04_022429

Reference: OH-1004 Chr: Chr04 Coordinates: 150220699-150224782 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2091 bp · LXL04_022429|LXL04_022429|OH1004|cDNA

ATGGCGGATTCCAGCCTTCATCGCTCCATTAATGGAACTCACCCATCTCAAAAATTAAACTTTTTCTTTCCAAATTTGACTTCAAACACAAGTGAAATGAAGAAATCGAGAGCTGTTGTCTTTCttatattttgtttgttttttcgatGTGTGTTGAGTGGTGATAGAGAAGCACTTCTGGAACTAAAATCATCCATGGATACTTCGAGTTCTTTACAATGGAGAGGAAGTGATTTCTGCAAATGGGAAGGAGTTCGAGA...

CDS

Download CDS FASTA

2091 bp · LXL04_022429|LXL04_022429|OH1004|CDS

ATGGCGGATTCCAGCCTTCATCGCTCCATTAATGGAACTCACCCATCTCAAAAATTAAACTTTTTCTTTCCAAATTTGACTTCAAACACAAGTGAAATGAAGAAATCGAGAGCTGTTGTCTTTCTTATATTTTGTTTGTTTTTTCGATGTGTGTTGAGTGGTGATAGAGAAGCACTTCTGGAACTAAAATCATCCATGGATACTTCGAGTTCTTTACAATGGAGAGGAAGTGATTTCTGCAAATGGGAAGGAGTTCGAGA...

Protein

Download Protein FASTA

696 aa · LXL04_022429|LXL04_022429|OH1004|PROTEIN

MADSSLHRSINGTHPSQKLNFFFPNLTSNTSEMKKSRAVVFLIFCLFFRCVLSGDREALLELKSSMDTSSSLQWRGSDFCKWEGVRECLRGRVSKLVLENLNLTGALDSSIVNQLDQIRVLSLKQNSISGQIPDLSGLTNLKSLYLSHNNFSGEFPASLTTLHRLKIIVLSSNRLSGTIPDSLLDLQRLYVFHVDDNIFTGKIPPFSQTTLTYLNLSNNQLSGEIPMTRTLLRFNSTSFTGNIDLCSNSFSIPCGFAPSP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_022429`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_022429

Location Chr04:150220699-150224782 (-)

Description Similar to At1g60630: Inactive leucine-rich repeat receptor-like serine/threonine-protein kinase At1g60630

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g60630`	Inactive leucine-rich repeat receptor-like serine/threonine-protein kinase At1g60630.	No verified direct reference in this release
`At5g67200`	Probable inactive receptor kinase At5g67200.	No verified direct reference in this release
`At2g26730`	Probable inactive receptor kinase At2g26730.	No verified direct reference in this release
`At1g68400`	Probable leucine-rich repeat receptor-like protein kinase At1g68400.	No verified direct reference in this release
`At5g58300`	Probable inactive receptor kinase At5g58300.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022429 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0005777 peroxisome Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009898 cytoplasmic side of plasma membrane Cellular Component

GO:0016328 lateral plasma membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0106310 protein serine kinase activity Molecular Function

KEGG gene cross-reference

ath:AT1G60630

ath:AT1G68400

ath:AT2G26730

ath:AT5G58300

ath:AT5G67200

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.868

Rank 1 · LXL04_022429 · OH-1004

Endoplasmic reticulum0.084

Rank 2 · LXL04_022429 · OH-1004

Cytoplasm0.079

Rank 3 · LXL04_022429 · OH-1004

Nucleus0.061

Rank 4 · LXL04_022429 · OH-1004

Lysosome / Vacuole0.021

Rank 5 · LXL04_022429 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08263.18LRRNT_253-85 aa

PF13855.13LRR_893-151 aa

PF12799.14LRR_4118-154 aa

PF13855.13LRR_8139-197 aa

PF00069.32Pkinase377-655 aa

PF07714.24PK_Tyr_Ser-Thr378-606 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_022429	`PF08263.18`	LRRNT_2	53	85	2.5e-07	31.6
LXL04_022429	`PF13855.13`	LRR_8	93	151	5.3e-10	39.6
LXL04_022429	`PF12799.14`	LRR_4	118	154	2.1e-10	41.2
LXL04_022429	`PF13855.13`	LRR_8	139	197	5.3e-10	39.6
LXL04_022429	`PF00069.32`	Pkinase	377	655	8.8e-25	88.3
LXL04_022429	`PF07714.24`	PK_Tyr_Ser-Thr	378	606	7.6e-25	88.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84MA9`	Arabidopsis thaliana	Inactive leucine-rich repeat receptor-like serine/threonine-protein kinase At1g60630	54.252%	Swiss-Prot	strong database homology
`Q93Y06`	Arabidopsis thaliana	Probable inactive receptor kinase At5g67200	38.565%	Swiss-Prot	moderate database homology
`O48788`	Arabidopsis thaliana	Probable inactive receptor kinase At2g26730	38.675%	Swiss-Prot	moderate database homology
`Q9M9C5`	Arabidopsis thaliana	Probable leucine-rich repeat receptor-like protein kinase At1g68400	36.999%	Swiss-Prot	moderate database homology
`Q9LVM0`	Arabidopsis thaliana	Probable inactive receptor kinase At5g58300	34.451%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card