TkA05G408450 | RubberDandelionOmics

Gene overview

TkA05G408450

Reference: TK1151 Chr: Chr05 Coordinates: 101555858-101571735 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

5466 bp · TkA05G408450|TK1151|cDNA

TGCTGAGGAAGGAATGGATTGCAAAACGACGGCGCATAGGAAGCAGGAGGAGGCACAACGACGTAGCATCGAAATGCACTGGTACTAAGCCCACCCTATTTAATATAGAGAATAATATCAAAAGAGGCAAGGCTGCAATGATCACACCCGGCTTACTGTAGCGCCACCGGCGTAAATTAGTCGTCTTCACTCTGCTATCTCTGTAGTACGGTCATTTCCGATTCTCCTGCAAAACCCTTCTCAGTTCTCCCCCATTTCCT...

CDS

Download CDS FASTA

4935 bp · TkA05G408450|TK1151|CDS

ATGAATAGTCAGCGACTATCCCTAACACCACAAAAGAGATCAAATGAAAGCTCCGAAGTTGGGGGTTTCAAGCGTAGGACTCCGGATTCGTTGGTAGTAAGTAGTCCAGATGTTTCAGGCTCAGGAAGAGTTTACAAGCTGAAGATTCTCTTACCGAACGGGATGACTGTATTGTTGAAGATTCCTGAAGGAACTGAATGGATTACTGTCAAAGAGTTGGCTAACAGAGCAAAAAATAGTTACGATAGAGCTGTGAAGAA...

Protein

Download Protein FASTA

1644 aa · TkA05G408450|TK1151|PROTEIN

MNSQRLSLTPQKRSNESSEVGGFKRRTPDSLVVSSPDVSGSGRVYKLKILLPNGMTVLLKIPEGTEWITVKELANRAKNSYDRAVKKTSNPEKHVNWNADLYFLDDTDKRFSNSLKLTNLELNRVYNLRLRDGSAPAKIYENMWDLTPDTEILKELPEEYTFETALADIIDNSLQAVWSNDQQERRLISVEVSDDMISIVDTGPGMDNMSLEKWGKMGASLHRASKGQAIGGKPPYLKPAFGMFGYGGFVASMHLGRITE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G408450`
TK1151 ID	TkA05G408450
OH-1004 ID	LXL04_021588
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	98.600
Protein coverage (%)	TK1151 97.263 / OH-1004 72.182 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G408450

Location Chr05:101555858-101571735 (+)

Description Similar to GMI1: Structural maintenance of chromosomes flexible hinge domain-containing protein GMI1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g24280`	Contributes to DNA double-strand break (DSB) repair via somatic homologous recombination.	GMI1, a structural-maintenance-of-chromosomes-hinge domain-containing protein, is involved in somatic homologous recombination in Arabidopsis.2011 · DOI: 10.1111/j.1365-313x.2011.04604.x
`At3g49250`	Component of the RNA-directed DNA methylation (RdDM) machinery, probably by facilitating an RNAi-mediated epigenetic modification involving secondary siRNAs and spreading of DNA methylation, thus leading to gene silencing.	A structural-maintenance-of-chromosomes hinge domain-containing protein is required for RNA-directed DNA methylation.2008 · DOI: 10.1038/ng.119 RNA polymerase V transcription guides ARGONAUTE4 to chromatin.2009 · DOI: 10.1038/ng.365 IDN1 and IDN2 are required for de novo DNA methylation in Arabidopsis thaliana.2009 · DOI: 10.1038/nsmb.1690 RNA polymerase V-dependent small RNAs in Arabidopsis originate from small, intergenic loci including most SINE repeats.2012 · DOI: 10.4161/epi.20290

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_021588 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0031047 regulatory ncRNA-mediated gene silencing Biological Process

GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process

GO:0000419 RNA polymerase V complex Cellular Component

GO:0005634 nucleus Cellular Component

GO:0042803 protein homodimerization activity Molecular Function

KEGG gene cross-reference

ath:AT3G49250

ath:AT5G24280

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.532

Rank 1 · TkA05G408450 · TK1151

Cytoplasm0.409

Rank 2 · TkA05G408450 · TK1151

Cell membrane0.095

Rank 3 · TkA05G408450 · TK1151

Endoplasmic reticulum0.065

Rank 4 · TkA05G408450 · TK1151

Mitochondrion0.063

Rank 5 · TkA05G408450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF28659GMI1_N45-132 aa

PF13589HATPase_c_3160-277 aa

PF02518HATPase_c163-222 aa

PF04778LMP399-446 aa

PF22899SMCHD1_S5425-574 aa

PF28657GMI1_middle580-717 aa

PF28626GMI1_Ig_1722-861 aa

PF28628GMI1_Ig_2866-983 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G408450	`PF28659`	GMI1_N	45	132	8.2e-20	71.7
TkA05G408450	`PF13589`	HATPase_c_3	160	277	1.2e-12	48.7
TkA05G408450	`PF02518`	HATPase_c	163	222	0.022	15.9
TkA05G408450	`PF04778`	LMP	399	446	0.03	14.9
TkA05G408450	`PF22899`	SMCHD1_S5	425	574	0.003	18.1
TkA05G408450	`PF28657`	GMI1_middle	580	717	2.1e-61	206.4
TkA05G408450	`PF28626`	GMI1_Ig_1	722	861	5.4e-53	179.1
TkA05G408450	`PF28628`	GMI1_Ig_2	866	983	9.9e-32	110.1
TkA05G408450	`PF22899`	SMCHD1_S5	868	904	0.003	18.1
TkA05G408450	`PF28627`	GMI1_Ig_3	876	913	1.4e-37	128.4
TkA05G408450	`PF26199`	Ig_SMCHD1_8th	886	948	0.1	13.5
TkA05G408450	`PF28627`	GMI1_Ig_3	987	1087	1.4e-37	128.4
TkA05G408450	`PF28628`	GMI1_Ig_2	1003	1046	9.9e-32	110.1
TkA05G408450	`PF26199`	Ig_SMCHD1_8th	1005	1033	0.1	13.5
TkA05G408450	`PF28658`	GMI1_Ig_4th	1091	1192	1.3e-37	128.6
TkA05G408450	`PF02518`	HATPase_c	1242	1271	0.022	15.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4KFS5`	Arabidopsis thaliana	sp\|F4KFS5\|GMI1_ARATH Structural maintenance of chromosomes flexible hinge domain-containing protein GMI1	41.300%	Swiss-Prot	Medium
`Q94A79`	Arabidopsis thaliana	sp\|Q94A79\|DMS3_ARATH Protein DEFECTIVE IN MERISTEM SILENCING 3	37.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card