TkA05G399020 | RubberDandelionOmics

Gene overview

TkA05G399020

Reference: TK1151 Chr: Chr05 Coordinates: 99210170-99213743 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2251 bp · TkA05G399020|TK1151|cDNA

AGGACTCTCAAAAGCTTCGCGAACTTAAAACCCTTTGATTTAGGTCTCCTTTCCCTTCTCTCTTTCTGTGTTATCTATCCTCTTATCATTCCACCACGAACAAACCAACCTACACTTTCGATTTTATTTTGGAAAATCCGCCATAAATCTACCCCGTTTGCAGGTAGCTCCCATTAATCAACGTCAACAAAACATGGCATCTGCATCTCCCAATATTTGGGTTTTGCTGGGTTTGAGTTTGGCCGGAATACTGTTGATGG...

CDS

Download CDS FASTA

1779 bp · TkA05G399020|TK1151|CDS

ATGGCATCTGCATCTCCCAATATTTGGGTTTTGCTGGGTTTGAGTTTGGCCGGAATACTGTTGATGGCGAAGAAGCTTAAGAAAGTCGTCAAAGCTGACTTTGGGGCATTCGTGGAGCGGTTTCAGTTACTACCTCCGCCGCAGCCGGCTCCTCCAAAAGCCCCTCATCCGCTCACTGGCCTCTCCTTTGCCGTCTCCGACCTATTCGACATCAATGGGTTTGTAACCGGATTCGGCACTCCAGACTGGGAAAGGACACA...

Protein

Download Protein FASTA

592 aa · TkA05G399020|TK1151|PROTEIN

MASASPNIWVLLGLSLAGILLMAKKLKKVVKADFGAFVERFQLLPPPQPAPPKAPHPLTGLSFAVSDLFDINGFVTGFGTPDWERTHEAASQTSPVVSALVDGGATCVGKTVVDEMSFGISGENRHYDAPTNPVAPSRIPGGSCSGAAVAVAAKLVDFSLGVDTVGGVRQPAAHCGILGFKPSFGSVSHSGIIPISTSFDTVGWFAMDPSILRRVGQVLLQVPLTIQRNPRNVIIADDCFKLSKIPVDRLTQVVIKSTET...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G399020`
TK1151 ID	TkA05G399020
OH-1004 ID	LXL04_017125
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	46.700
Protein coverage (%)	TK1151 99.324 / OH-1004 60.142 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G399020

Location Chr05:99210170-99213743 (+)

Description Similar to OM64: Outer envelope protein 64, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g17970`	Chaperone receptor mediating Hsp90-dependent protein targeting to chloroplasts.	Toc64/OEP64 is not essential for the efficient import of proteins into chloroplasts in Arabidopsis thaliana.2007 · DOI: 10.1111/j.1365-313x.2007.03207.x
`At5g09420`	Chaperone receptor mediating Hsp90-dependent protein targeting to mitochondria.	No verified direct reference in this release
`At1g08980`	Amidase involved in auxin biosynthesis.	Molecular cloning and characterization of an amidase from Arabidopsis thaliana capable of converting indole-3-acetamide into the plant growth hormone, indole-3-acetic acid.2003 · DOI: 10.1016/s0031-9422(02)00563-0 Characterization of Four Bifunctional Plant IAM/PAM-Amidohydrolases Capable of Contributing to Auxin Biosynthesis.2014 · DOI: 10.3390/plants3030324

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0118100`	Amidase involved in auxin biosynthesis (Probable).	Characterization of Four Bifunctional Plant IAM/PAM-Amidohydrolases Capable of Contributing to Auxin Biosynthesis.2014 · DOI: 10.3390/plants3030324

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017125 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006626 protein targeting to mitochondrion Biological Process

GO:0009684 indoleacetic acid biosynthetic process Biological Process

GO:0009851 auxin biosynthetic process Biological Process

GO:0015031 protein transport Biological Process

GO:0030150 protein import into mitochondrial matrix Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005654 nucleoplasm Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G08980

ath:AT3G17970

ath:AT5G09420

dosa:Os04g0118100

osa:4334958

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.451

Rank 1 · TkA05G399020 · TK1151

Cytoplasm0.252

Rank 2 · TkA05G399020 · TK1151

Peroxisome0.196

Rank 3 · TkA05G399020 · TK1151

Nucleus0.100

Rank 4 · TkA05G399020 · TK1151

Plastid0.098

Rank 5 · TkA05G399020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13414TPR_115-15 aa

PF01425Amidase55-208 aa

PF23606HEAT_ULK4276-337 aa

PF01425Amidase349-441 aa

PF25575TPR_BSK1_C443-542 aa

PF29407CFAP70_TPR_C444-539 aa

PF07719TPR_2477-507 aa

PF13424TPR_12477-505 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G399020	`PF13414`	TPR_11	5	15	2e-06	28.1
TkA05G399020	`PF01425`	Amidase	55	208	4.7e-51	174.9
TkA05G399020	`PF23606`	HEAT_ULK4	276	337	0.013	15.6
TkA05G399020	`PF01425`	Amidase	349	441	4.7e-51	174.9
TkA05G399020	`PF25575`	TPR_BSK1_C	443	542	7.6e-06	26.5
TkA05G399020	`PF29407`	CFAP70_TPR_C	444	539	0.0042	17.3
TkA05G399020	`PF07719`	TPR_2	477	507	1.3e-13	50.6
TkA05G399020	`PF13424`	TPR_12	477	505	0.22	12.4
TkA05G399020	`PF00515`	TPR_1	480	507	8.9e-14	51.3
TkA05G399020	`PF13432`	TPR_16	482	540	4.2e-05	24.6
TkA05G399020	`PF13428`	TPR_14	483	507	0.14	13.6
TkA05G399020	`PF25063`	ARM_TT21_C	485	574	0.25	11.9
TkA05G399020	`PF13414`	TPR_11	487	524	2e-06	28.1
TkA05G399020	`PF13371`	TPR_9	487	542	0.0025	18.5
TkA05G399020	`PF14559`	TPR_19	487	508	0.21	12.7
TkA05G399020	`PF04212`	MIT	488	505	0.29	12.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LVH5`	Arabidopsis thaliana	sp\|Q9LVH5\|OE64C_ARATH Outer envelope protein 64, chloroplastic	65.300%	Swiss-Prot	High
`F4KCL7`	Arabidopsis thaliana	sp\|F4KCL7\|OE64M_ARATH Outer envelope protein 64, mitochondrial	48.000%	Swiss-Prot	Medium
`Q9FR37`	Arabidopsis thaliana	sp\|Q9FR37\|AMI1_ARATH Amidase 1	48.900%	Swiss-Prot	Medium
`Q7XTK3`	Oryza sativa subsp. japonica	sp\|Q7XTK3\|AMI1_ORYSJ Amidase 1	47.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card