TkA05G338900 | RubberDandelionOmics

Gene overview

TkA05G338900

Reference: TK1151 Chr: Chr05 Coordinates: 83783650-83786455 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1133 bp · TkA05G338900|TK1151|cDNA

GTCACTGTTCCGTCATCCCCTCCGCTCGAAGTGCAAACCCTCCCGTAACTCTTGGCTTTTCCATCGCTTAATGATACGAGTCATACCCATTTCGATACGATAGTCGGCCTCGGAAATGGCGGATCAGAGTAGCAATCCTCCAGCCAGGGAAGGAATGCTGACCTACTGCTACCTCCTTCTCTACATAGCCCTCTCCAACGGCCAGATCTTCTTCAACAAGTTCACAGACAAACGTTTTCAACCTGTTCATGATTTAATGA...

CDS

Download CDS FASTA

900 bp · TkA05G338900|TK1151|CDS

ATGGCGGATCAGAGTAGCAATCCTCCAGCCAGGGAAGGAATGCTGACCTACTGCTACCTCCTTCTCTACATAGCCCTCTCCAACGGCCAGATCTTCTTCAACAAGTTCACAGACAAACGTTTTCAACCTGTTCATGATTTAATGATTGGTGTAGATTTTGGTGCCAGAATGATCACCATTGACAACAAACCAATAAAGCTCCAGATCTGGGACACGGCGGGTCAGGAATCGTTCAGATCCATAACAAGATCTTACTACAG...

Protein

Download Protein FASTA

299 aa · TkA05G338900|TK1151|PROTEIN

MADQSSNPPAREGMLTYCYLLLYIALSNGQIFFNKFTDKRFQPVHDLMIGVDFGARMITIDNKPIKLQIWDTAGQESFRSITRSYYRGAAGALLVYDITRRETFNHLASWLEDARQHANANMTVMLIGNKCDLAHRRAVSTEEGEQFAKENGLIFMEDELGQPLESVFSKISSESIAAASLGQVYRATLRDSGEDVAIKVQRPEIEPIIYRDLFLFRTLASFLNGTSLQKLGCNAELIVDEFGEKLLEELDYTLVPKQPG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G338900`
TK1151 ID	TkA05G338900
OH-1004 ID	LXL04_020995
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	84.700
Protein coverage (%)	TK1151 100.000 / OH-1004 94.304 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G338900

Location Chr05:83783650-83786455 (-)

Description Similar to RABB1C: Ras-related protein RABB1c

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g17170`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release
`At4g31390`	Kinase that can phosphorylate the tocopherol cyclase VTE1, a key enzyme of tocopherol (vitamin E) metabolism and involved in the recycling of oxidated alpha-tocopherol quinone, possibly stabilizing it at plastoglobules.	AtACDO1, an ABC1-like kinase gene, is involved in chlorophyll degradation and the response to photooxidative stress in Arabidopsis.2012 · DOI: 10.1093/jxb/ers072 Loss of plastoglobule kinases ABC1K1 and ABC1K3 causes conditional degreening, modified prenyl-lipids, and recruitment of the jasmonic acid pathway.2013 · DOI: 10.1105/tpc.113.111120 ABC1K1/PGR6 kinase: a regulatory link between photosynthetic activity and chloroplast metabolism.2014 · DOI: 10.1111/tpj.12385
`At1g71810`	Uncharacterized aarF domain-containing protein kinase At1g71810, chloroplastic.	No verified direct reference in this release
`At1g79600`	Kinase that can phosphorylate the tocopherol cyclase VTE1, a key enzyme of tocopherol (vitamin E) metabolism and involved in the recycling of oxidated alpha-tocopherol quinone, possibly stabilizing it at plastoglobules.	A chloroplast ABC1-like kinase regulates vitamin E metabolism in Arabidopsis.2013 · DOI: 10.1104/pp.113.218644 Loss of plastoglobule kinases ABC1K1 and ABC1K3 causes conditional degreening, modified prenyl-lipids, and recruitment of the jasmonic acid pathway.2013 · DOI: 10.1105/tpc.113.111120

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020995 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009637 response to blue light Biological Process

GO:0009767 photosynthetic electron transport chain Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0010109 regulation of photosynthesis Biological Process

GO:0010114 response to red light Biological Process

GO:0015031 protein transport Biological Process

GO:0015996 chlorophyll catabolic process Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0031540 regulation of anthocyanin biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT4G17170

ath:AT4G31390

zma:100127017

zma:100127494

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.403

Rank 1 · TkA05G338900 · TK1151

Endoplasmic reticulum0.211

Rank 2 · TkA05G338900 · TK1151

Golgi apparatus0.190

Rank 3 · TkA05G338900 · TK1151

Nucleus0.174

Rank 4 · TkA05G338900 · TK1151

Cell membrane0.154

Rank 5 · TkA05G338900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00071Ras33-157 aa

PF08477Roc33-132 aa

PF00025Arf54-143 aa

PF00009GTP_EFTU57-140 aa

PF17920TetR_C_1668-123 aa

PF03109ABC1147-253 aa

PF17920TetR_C_16165-179 aa

PF02902Peptidase_C48254-279 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G338900	`PF00071`	Ras	33	157	1.5e-44	152.2
TkA05G338900	`PF08477`	Roc	33	132	9.5e-24	84.6
TkA05G338900	`PF00025`	Arf	54	143	5.4e-09	36.5
TkA05G338900	`PF00009`	GTP_EFTU	57	140	0.002	18.5
TkA05G338900	`PF17920`	TetR_C_16	68	123	0.12	13.3
TkA05G338900	`PF03109`	ABC1	147	253	9.2e-26	91.2
TkA05G338900	`PF17920`	TetR_C_16	165	179	0.12	13.3
TkA05G338900	`PF02902`	Peptidase_C48	254	279	0.016	15.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`P92963`	Arabidopsis thaliana	sp\|P92963\|RAB1C_ARATH Ras-related protein RABB1c	80.200%	Swiss-Prot	High
`Q8RWG1`	Arabidopsis thaliana	sp\|Q8RWG1\|AB1K1_ARATH Protein ACTIVITY OF BC1 COMPLEX KINASE 1, chloroplastic	74.800%	Swiss-Prot	Medium
`Q94BU1`	Arabidopsis thaliana	sp\|Q94BU1\|Y1181_ARATH Uncharacterized aarF domain-containing protein kinase At1g71810, chloroplastic	43.400%	Swiss-Prot	Medium
`Q9MA15`	Arabidopsis thaliana	sp\|Q9MA15\|AB1K3_ARATH Protein ACTIVITY OF BC1 COMPLEX KINASE 3, chloroplastic	42.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card