LXL04_020995 | RubberDandelionOmics

Gene overview

LXL04_020995

Reference: OH-1004 Chr: Chr04 Coordinates: 118084526-118087101 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

951 bp · LXL04_020995|LXL04_020995|OH1004|cDNA

ATGGCGGATCAGAGTAGCAATCCTCCAGCCAGGGAAGGAATGCTGACCTACTGCTACCTCCTTCTCTACATAGCCCTCTCCAGCGGCCAGATCTTCTTCAACAAGGTCATATTTCTGCTGCACAATAAATCTGAAGAATCATGTCTTACGCCTACCTCTTCAAGTACATCATCATTGGAGATACCGGCGGGTCAGGAATCGTTCAGATCCATAACAAGATCTTACTACAGAGGTGCAGCTGGTTCACTTTTGGTTTATGA...

CDS

Download CDS FASTA

951 bp · LXL04_020995|LXL04_020995|OH1004|CDS

ATGGCGGATCAGAGTAGCAATCCTCCAGCCAGGGAAGGAATGCTGACCTACTGCTACCTCCTTCTCTACATAGCCCTCTCCAGCGGCCAGATCTTCTTCAACAAGGTCATATTTCTGCTGCACAATAAATCTGAAGAATCATGTCTTACGCCTACCTCTTCAAGTACATCATCATTGGAGATACCGGCGGGTCAGGAATCGTTCAGATCCATAACAAGATCTTACTACAGAGGTGCAGCTGGTTCACTTTTGGTTTATGA...

Protein

Download Protein FASTA

316 aa · LXL04_020995|LXL04_020995|OH1004|PROTEIN

MADQSSNPPAREGMLTYCYLLLYIALSSGQIFFNKVIFLLHNKSEESCLTPTSSSTSSLEIPAGQESFRSITRSYYRGAAGSLLVYDITRRETFNHLASWLEDARQHANANMTVMLIGNKCDLAHRRAVSTEEGEQFAKENGLIFMEEELGQPLESVFSKISSETIAAASLGQVYMATLRDSGEDVAIKVQRPEIEPIIYRDLFLFRTLASFLNGTSLQKLGCNAELIVDEFGEKLLEELDYTLVPKQPGNTECGYYVCK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_020995`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_020995

Location Chr04:118084526-118087101 (-)

Description Similar to RABB1C: Ras-related protein RABB1c

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g31390`	Kinase that can phosphorylate the tocopherol cyclase VTE1, a key enzyme of tocopherol (vitamin E) metabolism and involved in the recycling of oxidated alpha-tocopherol quinone, possibly stabilizing it at plastoglobules.	AtACDO1, an ABC1-like kinase gene, is involved in chlorophyll degradation and the response to photooxidative stress in Arabidopsis.2012 · DOI: 10.1093/jxb/ers072 Loss of plastoglobule kinases ABC1K1 and ABC1K3 causes conditional degreening, modified prenyl-lipids, and recruitment of the jasmonic acid pathway.2013 · DOI: 10.1105/tpc.113.111120 ABC1K1/PGR6 kinase: a regulatory link between photosynthetic activity and chloroplast metabolism.2014 · DOI: 10.1111/tpj.12385
`At4g17170`	Intracellular vesicle trafficking and protein transport.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_020995 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009637 response to blue light Biological Process

GO:0009767 photosynthetic electron transport chain Biological Process

GO:0010027 thylakoid membrane organization Biological Process

GO:0010109 regulation of photosynthesis Biological Process

GO:0010114 response to red light Biological Process

GO:0015031 protein transport Biological Process

GO:0015996 chlorophyll catabolic process Biological Process

GO:0016192 vesicle-mediated transport Biological Process

GO:0031540 regulation of anthocyanin biosynthetic process Biological Process

KEGG gene cross-reference

ath:AT4G17170

ath:AT4G31390

zma:100127017

zma:100127494

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.405

Rank 1 · LXL04_020995 · OH-1004

Nucleus0.227

Rank 2 · LXL04_020995 · OH-1004

Endoplasmic reticulum0.208

Rank 3 · LXL04_020995 · OH-1004

Golgi apparatus0.154

Rank 4 · LXL04_020995 · OH-1004

Cell membrane0.139

Rank 5 · LXL04_020995 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00071.29Ras63-148 aa

PF08477.20Roc63-122 aa

PF03109.23ABC1137-243 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_020995	`PF00071.29`	Ras	63	148	9.2e-30	104.1
LXL04_020995	`PF08477.20`	Roc	63	122	6.8e-12	46.4
LXL04_020995	`PF03109.23`	ABC1	137	243	2.1e-25	90.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RWG1`	Arabidopsis thaliana	Protein ACTIVITY OF BC1 COMPLEX KINASE 1, chloroplastic	85.185%	Swiss-Prot	weak database homology
`P92963`	Arabidopsis thaliana	Ras-related protein RABB1c	83.495%	Swiss-Prot	weak database homology

JBrowse

View in Genome Browser

Gene Card