TkA05G115510 | RubberDandelionOmics

Gene overview

TkA05G115510

Reference: TK1151 Chr: Chr05 Coordinates: 30817388-30823942 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

429 bp · TkA05G115510|TK1151|cDNA

ATGAGTATAGCCAACCAAAAGGCTTGCTCAGAATACCTAGACGCTGTTGAAGCTACTGAAGAAATTGAATCACCAGCACTCGGGTTTGTAAGGCCATCAGATTACAAATCCGCTATAACCCTGCAAAATTCAGCAATTATCAAGCAAAATAATATACTCGTATATCTCCTGATAAAACAAGCTCAAAGATTCGGAGACTTTGAAGAAAAGCTTGAAAAGATAAAACGTGACCTGGAAGCCATCGGGAAAAGAGAGTCAGA...

CDS

Download CDS FASTA

2379 bp · TkA05G115510|TK1151|CDS

ATGGTCGGACCTCTGGTTCGTGCTCTCTGGTCCACCACCAGAAAATCCATCTCCACCTCCTCCTCCCCGTCTTCCTATCTCAAACCATTCATACTTGCTCGCGCCTCGGGCATTTCACGCTCCTTCTCCGTGGCCACAGCGACAGCTGCTGCCAACGCGACTGCTCCTGGCGGCGCACTGGATCCGAACCGGCTCCGCAACGTAGCGGTGATTGCCCATGTCGATCATGGCAAGACCACTCTTATGGATCGTCTACTTCG...

Protein

Download Protein FASTA

792 aa · TkA05G115510|TK1151|PROTEIN

MVGPLVRALWSTTRKSISTSSSPSSYLKPFILARASGISRSFSVATATAAANATAPGGALDPNRLRNVAVIAHVDHGKTTLMDRLLRQCGADIPHERALDSNQLEKERGITIASKITSIPWKENELNMVDTPGHADFGGEVERVVGMVEGAILVVDAGEGPLAQTKFVLAKALRYGLRPILLLNKVDRPSVSEERCDEVESLVFDLFANLEEQLDFPVLYASAKEGWASLTYTKNPPDDAKNMAQLLDAIVKYVPPPTAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G115510`
TK1151 ID	TkA05G115510
OH-1004 ID	LXL04_019998
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	95.300
Protein coverage (%)	TK1151 80.556 / OH-1004 97.623 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA05G115510`
Location	Chr05:30817388-30823942 (-)
Description	Similar to bipA: 50S ribosomal subunit assembly factor BipA (Helicobacter pylori (strain ATCC 700392 / 26695)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_019998` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000027 ribosomal large subunit assembly Biological Process GO:0006412 translation Biological Process GO:0009408 response to heat Biological Process GO:0009409 response to cold Biological Process GO:0010467 gene expression Biological Process GO:0005829 cytosol Cellular Component GO:1990904 ribonucleoprotein complex Cellular Component GO:0000049 tRNA binding Molecular Function GO:0003924 GTPase activity Molecular Function GO:0005525 GTP binding Molecular Function GO:0019843 rRNA binding Molecular Function GO:0043022 ribosome binding Molecular Function
KEGG gene cross-reference	ecc:c4820 ecj:JW5571 eco:b3871 ecoc:C3026_20930 heo:C694_02460 hpj:jhp_0432 hpy:HP_0480 sfl:SF3941 sfx:S3805 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.562

Rank 1 · TkA05G115510 · TK1151

Plastid0.451

Rank 2 · TkA05G115510 · TK1151

Cytoplasm0.045

Rank 3 · TkA05G115510 · TK1151

Nucleus0.038

Rank 4 · TkA05G115510 · TK1151

Cell membrane0.013

Rank 5 · TkA05G115510 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00009GTP_EFTU64-256 aa

PF01926MMR_HSR168-185 aa

PF03193RsgA_GTPase77-137 aa

PF03193RsgA_GTPase146-225 aa

PF22042EF-G_D2264-354 aa

PF03144GTP_EFTU_D2279-352 aa

PF21018BipA_C404-443 aa

PF00679EFG_C443-526 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G115510	`PF00009`	GTP_EFTU	64	256	4e-53	180.5
TkA05G115510	`PF01926`	MMR_HSR1	68	185	0.00012	22.9
TkA05G115510	`PF03193`	RsgA_GTPase	77	137	0.0069	16.9
TkA05G115510	`PF03193`	RsgA_GTPase	146	225	0.0069	16.9
TkA05G115510	`PF22042`	EF-G_D2	264	354	9.2e-06	26.4
TkA05G115510	`PF03144`	GTP_EFTU_D2	279	352	7.6e-08	33.4
TkA05G115510	`PF21018`	BipA_C	404	443	6e-41	139.3
TkA05G115510	`PF00679`	EFG_C	443	526	1.1e-19	70.9
TkA05G115510	`PF21018`	BipA_C	533	634	6e-41	139.3
TkA05G115510	`PF03193`	RsgA_GTPase	539	568	0.0069	16.9
TkA05G115510	`PF01926`	MMR_HSR1	694	725	0.00012	22.9
TkA05G115510	`PF03193`	RsgA_GTPase	697	754	0.0069	16.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card