LXL04_019998 | RubberDandelionOmics

Gene overview

LXL04_019998

Reference: OH-1004 Chr: Chr04 Coordinates: 46705116-46709615 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2200 bp · LXL04_019998|LXL04_019998|OH1004|cDNA

GAAAACCGATTCGGACACAGAGCATCGCCTAACTGCGAAACCAAAATGGTCGGACCTCTGGTTCGTGCTCTCTGGTCCACCACCAGAAAATCCATCTCCACCTCCTCCTCCCCGTCTTCCTATCTCAAACCATTCATACATGCTCGCGCCGCGGGCATTTCACGCTCCTTCTCCGTGGCCACAGCGACAGCTGCTGCCAACGCGACTGCTCCTGGCGGCGCACTGGATCCGAACCGGCTCCGCAACGTAGCGGTGATTGC...

CDS

Download CDS FASTA

2022 bp · LXL04_019998|LXL04_019998|OH1004|CDS

ATGGTCGGACCTCTGGTTCGTGCTCTCTGGTCCACCACCAGAAAATCCATCTCCACCTCCTCCTCCCCGTCTTCCTATCTCAAACCATTCATACATGCTCGCGCCGCGGGCATTTCACGCTCCTTCTCCGTGGCCACAGCGACAGCTGCTGCCAACGCGACTGCTCCTGGCGGCGCACTGGATCCGAACCGGCTCCGCAACGTAGCGGTGATTGCCCATGTCGATCATGGCAAGACCACTCTTATGGATCGTCTACTTCG...

Protein

Download Protein FASTA

673 aa · LXL04_019998|LXL04_019998|OH1004|PROTEIN

MVGPLVRALWSTTRKSISTSSSPSSYLKPFIHARAAGISRSFSVATATAAANATAPGGALDPNRLRNVAVIAHVDHGKTTLMDRLLRQCGADIPHERALDSNQLEKERGITIASKITSIPWKENELNMVDTPGHADFGGEVERVVGMVEGAILVVDAGEGPLAQTKFVLAKALRYGLRPILLLNKVDRPSVSEERCDEVESLVFDLFANLGASEEQLDFPVLYASAKEGWASLTYTKNPPDDAKNMSQLLDAIVKYVPPP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_019998`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_019998`
Location	Chr04:46705116-46709615 (-)
Description	Similar to bipA: 50S ribosomal subunit assembly factor BipA (Helicobacter pylori (strain ATCC 700392 / 26695)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_019998` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0000027 ribosomal large subunit assembly Biological Process GO:0006412 translation Biological Process GO:0009408 response to heat Biological Process GO:0009409 response to cold Biological Process GO:0010467 gene expression Biological Process GO:0005829 cytosol Cellular Component GO:1990904 ribonucleoprotein complex Cellular Component GO:0000049 tRNA binding Molecular Function GO:0003924 GTPase activity Molecular Function GO:0005525 GTP binding Molecular Function GO:0019843 rRNA binding Molecular Function GO:0043022 ribosome binding Molecular Function
KEGG gene cross-reference	ecc:c4820 ecj:JW5571 eco:b3871 ecoc:C3026_20930 heo:C694_02460 hpj:jhp_0432 hpy:HP_0480 sfl:SF3941 sfx:S3805 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.713

Rank 1 · LXL04_019998 · OH-1004

Plastid0.287

Rank 2 · LXL04_019998 · OH-1004

Cytoplasm0.042

Rank 3 · LXL04_019998 · OH-1004

Nucleus0.037

Rank 4 · LXL04_019998 · OH-1004

Cell membrane0.013

Rank 5 · LXL04_019998 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00009.34GTP_EFTU64-259 aa

PF03144.32GTP_EFTU_D2282-355 aa

PF00679.31EFG_C462-545 aa

PF21018.3BipA_C552-660 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_019998	`PF00009.34`	GTP_EFTU	64	259	2.6e-53	181.1
LXL04_019998	`PF03144.32`	GTP_EFTU_D2	282	355	7.1e-08	33.5
LXL04_019998	`PF00679.31`	EFG_C	462	545	9.1e-20	71.2
LXL04_019998	`PF21018.3`	BipA_C	552	660	1.7e-44	150.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card