TkA05G005390 | RubberDandelionOmics

Gene overview

TkA05G005390

Reference: TK1151 Chr: Chr05 Coordinates: 1617392-1623418 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4200 bp · TkA05G005390|TK1151|cDNA

CTTTCTAGTCGTAAAACCCTCTCTGTTGGTTTCATCCGACTTGCAGCGACAACATCGTCTTTTCCATATCTCACTCTGTTGTCTTCGTCTCTCTAGCCAAGGCGACTCTCTCTCTCTCTCTCTCTCTAGCGGAGGCACAGAGAATGGTAGTTGGATGCAAGTTTTGGCTGGTACAAAAGAAGAGGTTTTGTGCAGTTCCGCCGCTCCCCGATTCCGAGTTTTGCGGCAACCACTCTACAAGGCCGGGTGACAGGTGGATT...

CDS

Download CDS FASTA

3813 bp · TkA05G005390|TK1151|CDS

ATGGTAGTTGGATGCAAGTTTTGGCTGGTACAAAAGAAGAGGTTTTGTGCAGTTCCGCCGCTCCCCGATTCCGAGTTTTGCGGCAACCACTCTACAAGGCCGGGTGACAGGTGGATTTTGTGCTCGATAGATCCCTCCCACTCTGTACTGGAATCCAACCTCGAGAACCACCTTAGACGGTGTGCATTCCTCAAACATAACAACTTGCTGTCCCTCCAATCTTTCTACCAAAAGGGCATTAATGGAGGCGATGCAGACGT...

Protein

Download Protein FASTA

1270 aa · TkA05G005390|TK1151|PROTEIN

MVVGCKFWLVQKKRFCAVPPLPDSEFCGNHSTRPGDRWILCSIDPSHSVLESNLENHLRRCAFLKHNNLLSLQSFYQKGINGGDADVSSESKRMESGQYLGEISALCFLHLPPPSSSLPYLLAGSGSQLLFYDLHTGNMIASFQVFNGVRVHGISCSPPTDASLTFRVALFGERMLKLFLFTIQLPDHNKQTLVHLLSFQSLPNFGHWILDVCFMQDCEFLAIGCTDNSVYFWDTSTSTISYEVNSPDRCLLYTMRIWGD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA05G005390`
TK1151 ID	TkA05G005390
OH-1004 ID	LXL04_018959
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA05G005390

Location Chr05:1617392-1623418 (-)

Description Similar to WDR6: WD repeat-containing protein 6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0833200`	tRNA methylase that catalyzes 2'-O-methyladenosine (Am) nucleoside formation on tRNA(Gly)(GCC) in vitro.	The 2'-O-methyladenosine nucleoside modification gene OsTRM13 positively regulates salt stress tolerance in rice.2017 · DOI: 10.1093/jxb/erx061

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_018959 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0002130 wobble position ribose methylation Biological Process

GO:0008285 negative regulation of cell population proliferation Biological Process

GO:0010507 negative regulation of autophagy Biological Process

GO:0030488 tRNA methylation Biological Process

GO:0048009 insulin-like growth factor receptor signaling pathway Biological Process

GO:0070314 G1 to G0 transition Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0008180 COP9 signalosome Cellular Component

GO:0032991 protein-containing complex Cellular Component

GO:0000049 tRNA binding Molecular Function

KEGG gene cross-reference

bta:526884

hsa:11180

mmu:83669

pon:100174434

rno:301007

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.722

Rank 1 · TkA05G005390 · TK1151

Cytoplasm0.279

Rank 2 · TkA05G005390 · TK1151

Cell membrane0.054

Rank 3 · TkA05G005390 · TK1151

Endoplasmic reticulum0.043

Rank 4 · TkA05G005390 · TK1151

Mitochondrion0.032

Rank 5 · TkA05G005390 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11722zf-TRM13_CCCH5-30 aa

PF05253zf-U11-48K40-61 aa

PF23381Beta-prop_IFT122_1st120-145 aa

PF24805EIF3I122-245 aa

PF24817WD40_WDHD1_1st124-159 aa

PF25171Beta-prop_WDR36-Utp21_1st124-160 aa

PF25172Beta-prop_WDR3_2nd125-376 aa

PF24814WD40_Prp19125-157 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA05G005390	`PF11722`	zf-TRM13_CCCH	5	30	2.7e-11	43.6
TkA05G005390	`PF05253`	zf-U11-48K	40	61	0.00017	22.1
TkA05G005390	`PF23381`	Beta-prop_IFT122_1st	120	145	1.1e-15	58.4
TkA05G005390	`PF24805`	EIF3I	122	245	1.7e-07	31.5
TkA05G005390	`PF24817`	WD40_WDHD1_1st	124	159	7.2e-10	39.2
TkA05G005390	`PF25171`	Beta-prop_WDR36-Utp21_1st	124	160	9.5e-08	32.5
TkA05G005390	`PF25172`	Beta-prop_WDR3_2nd	125	376	1.4e-14	54.7
TkA05G005390	`PF24814`	WD40_Prp19	125	157	2.6e-14	53.7
TkA05G005390	`PF12894`	ANAPC4_WD40	127	147	0.0024	18.8
TkA05G005390	`PF25168`	Beta-prop_WDR36-Utp21_2nd	131	157	7.3e-10	39.3
TkA05G005390	`PF25168`	Beta-prop_WDR36-Utp21_2nd	181	240	7.3e-10	39.3
TkA05G005390	`PF24807`	WD40_CDC20-Fz	189	335	5.7e-16	59.4
TkA05G005390	`PF23414`	Beta-prop_EML_2	190	238	1.7e-12	48.0
TkA05G005390	`PF25175`	Beta-prop_WDR5	201	240	1.5e-18	67.8
TkA05G005390	`PF25391`	WD40_Gbeta	202	332	0.0088	15.8
TkA05G005390	`PF00400`	WD40	205	234	1.8e-26	92.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q10B19`	Oryza sativa subsp. japonica	sp\|Q10B19\|TRM13_ORYSJ tRNA:m(4)X modification enzyme TRM13	45.000%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card