LXL04_018959 | RubberDandelionOmics

Gene overview

LXL04_018959

Reference: OH-1004 Chr: Chr04 Coordinates: 20403133-20408695 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3819 bp · LXL04_018959|LXL04_018959|OH1004|cDNA

ATGGTAGTTGGATGCAAGTTTTGGCTGGTACAAAAGAAGAGGTTTTGTGCAATTCCGCCGCTCCCCGATTCCGAGTTTTGCGGCAACCACTCTACAAGGCCGGGTGACAGGTGGATTTTGTGCTCGATAGATCCCTCCCACTCTGTACTGGAATCCAACCTCGAGAACCACCTTAGACGGTGTGCATTCCTCAAACATAACAACTTGCTGTCCCTCCAATCTTTCTACCAAAAGGGCATTAATGGAGGCGATGCAGACGT...

CDS

Download CDS FASTA

3819 bp · LXL04_018959|LXL04_018959|OH1004|CDS

ATGGTAGTTGGATGCAAGTTTTGGCTGGTACAAAAGAAGAGGTTTTGTGCAATTCCGCCGCTCCCCGATTCCGAGTTTTGCGGCAACCACTCTACAAGGCCGGGTGACAGGTGGATTTTGTGCTCGATAGATCCCTCCCACTCTGTACTGGAATCCAACCTCGAGAACCACCTTAGACGGTGTGCATTCCTCAAACATAACAACTTGCTGTCCCTCCAATCTTTCTACCAAAAGGGCATTAATGGAGGCGATGCAGACGT...

Protein

Download Protein FASTA

1272 aa · LXL04_018959|LXL04_018959|OH1004|PROTEIN

MVVGCKFWLVQKKRFCAIPPLPDSEFCGNHSTRPGDRWILCSIDPSHSVLESNLENHLRRCAFLKHNNLLSLQSFYQKGINGGDADVSSESKRMESGQYLGEISALCFLHLPPPSSSLPYLLAGDLLRSGSQLLFYDLHTGNMIASFQVFNGVRVHGISCSPPTDASLTFRVALFGERMLKLFLFTIQLPDHNKQTLVHLLSFQSLPNFGHWILDVCFMQDCEFLAIGCTDNSVYFWDTSTSTISYEVNSPDRCLLYTMR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_018959`
TK1151 ID	TkA05G005390
OH-1004 ID	LXL04_018959
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`LXL04_018959`
Location	Chr04:20403133-20408695 (-)
Description	Similar to WDR6: WD repeat-containing protein 6
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_018959` · GCA_047496595.1_OSU_TarKok_2.0.
GO annotations (OH1004 source)	GO:0002130 wobble position ribose methylation Biological Process GO:0008285 negative regulation of cell population proliferation Biological Process GO:0010507 negative regulation of autophagy Biological Process GO:0030488 tRNA methylation Biological Process GO:0048009 insulin-like growth factor receptor signaling pathway Biological Process GO:0070314 G1 to G0 transition Biological Process GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0008180 COP9 signalosome Cellular Component GO:0032991 protein-containing complex Cellular Component GO:0000049 tRNA binding Molecular Function
KEGG gene cross-reference	bta:526884 hsa:11180 mmu:83669 pon:100174434 rno:301007 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.757

Rank 1 · LXL04_018959 · OH-1004

Cytoplasm0.248

Rank 2 · LXL04_018959 · OH-1004

Cell membrane0.053

Rank 3 · LXL04_018959 · OH-1004

Endoplasmic reticulum0.041

Rank 4 · LXL04_018959 · OH-1004

Golgi apparatus0.028

Rank 5 · LXL04_018959 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11722.14zf-TRM13_CCCH5-30 aa

PF25172.2Beta-prop_WDR3_2nd132-382 aa

PF24807.2WD40_CDC20-Fz193-381 aa

PF25173.2Beta-prop_WDR3_1st211-379 aa

PF24105.2Beta-prop_CAF1B_HIR1268-424 aa

PF25173.2Beta-prop_WDR3_1st270-422 aa

PF25175.2Beta-prop_WDR5270-434 aa

PF00400.39WD40298-333 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_018959	`PF11722.14`	zf-TRM13_CCCH	5	30	2.9e-11	43.5
LXL04_018959	`PF25172.2`	Beta-prop_WDR3_2nd	132	382	7e-14	52.5
LXL04_018959	`PF24807.2`	WD40_CDC20-Fz	193	381	1.3e-16	61.5
LXL04_018959	`PF25173.2`	Beta-prop_WDR3_1st	211	379	6.5e-23	82.1
LXL04_018959	`PF24105.2`	Beta-prop_CAF1B_HIR1	268	424	4.2e-07	30.0
LXL04_018959	`PF25173.2`	Beta-prop_WDR3_1st	270	422	6.5e-23	82.1
LXL04_018959	`PF25175.2`	Beta-prop_WDR5	270	434	1.2e-18	68.2
LXL04_018959	`PF00400.39`	WD40	298	333	1.5e-27	95.6
LXL04_018959	`PF25174.2`	Beta-prop_THOC3	305	461	1.5e-18	67.5
LXL04_018959	`PF25175.2`	Beta-prop_WDR5	350	426	1.2e-18	68.2
LXL04_018959	`PF23381.2`	Beta-prop_IFT122_1st	353	421	3.5e-15	56.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card