TkA04G143180 | RubberDandelionOmics

Gene overview

TkA04G143180

Reference: TK1151 Chr: Chr04 Coordinates: 37018196-37020364 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1599 bp · TkA04G143180|TK1151|cDNA

AACGACCCCACAAGTGTACAATCTGAGACTTTATTCTTAGAGTTCAGCTGTCACGTGTCAGCTCCCATCGTCGTTTATCGCCATCTAAATTGACCTCGATTCTACGTGGCAACATCATAGAAGCAACTAGTCGGCTTTCAGGGGCACCGTGAGCAGCCGCCCCTTCCGTTGCCTCCTTTATATTCTTCAACGAAAGGAAATTGTTTTCACTTTTGCCAACTTCTTTAGAGACGATGGTTAGTGTTAGATTTCTCGAGATC...

CDS

Download CDS FASTA

1182 bp · TkA04G143180|TK1151|CDS

ATGAAGCGTGTGTATGGCAGTCGCAAGAGTATGCTACCGATTGACGAGGATGTTGATTCGCCCGTTAAATGCAGGGAGCGACGTCGTCGTCGGATTGAGATGAGGCGGAGGTTGTCGTCAGTTTCCGCTGTTGCCGGAACTGATAACTTCGGTGGTCCGAAGCCAGCAGCCGCGGCGGAGTTGGAGAATGAGAACGCTGAGCCGTCGATTAGGAATGAGGAAACGCCGGAGTCACTGCTGTACGGGTCGATGTCGGTGGT...

Protein

Download Protein FASTA

393 aa · TkA04G143180|TK1151|PROTEIN

MKRVYGSRKSMLPIDEDVDSPVKCRERRRRRIEMRRRLSSVSAVAGTDNFGGPKPAAAAELENENAEPSIRNEETPESLLYGSMSVVGRAREMEDEISVQMNLCRPEINGYRPVHFFGVFDGHGGHHVSALCKENMHVIMEDELMRVKPTGDKLNRGEVEELWRTAIDRSFERMDEMALSLCQCNGLENLKMCRYHPQLSLVGSTAVVSLLTDEFIIVANCGDSRAVLCHNGKTVPLSVDHKPDREDERNRIEASGGRVL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA04G143180`
TK1151 ID	TkA04G143180
OH-1004 ID	LXL04_035317
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA04G143180

Location Chr04:37018196-37020364 (-)

Description Similar to AHG1: Probable protein phosphatase 2C 75

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51760`	Negative regulator of abscisic acid (ABA) responses during seed germination.	ABA-Hypersensitive Germination1 encodes a protein phosphatase 2C, an essential component of abscisic acid signaling in Arabidopsis seed.2007 · DOI: 10.1111/j.1365-313x.2007.03107.x
`At2g29380`	Probable protein phosphatase 2C 24.	No verified direct reference in this release
`At1g07430`	Involved in the negative regulation of the K(+) potassium channel AKT1 by its dephosphorylation, antagonistically to CIPK proteins (e.g. CIPK23).	No verified direct reference in this release
`At5g59220`	Acts as a negative regulator of abscisic acid (ABA) signaling for stomatal closure in leaves, and controls water loss during leaf senescence.	An ABA-regulated and Golgi-localized protein phosphatase controls water loss during leaf senescence in Arabidopsis.2012 · DOI: 10.1111/j.1365-313x.2011.04821.x An abscisic acid-AtNAP transcription factor-SAG113 protein phosphatase 2C regulatory chain for controlling dehydration in senescing Arabidopsis leaves.2012 · DOI: 10.1104/pp.111.190876 Selective inhibition of clade A phosphatases type 2C by PYR/PYL/RCAR abscisic acid receptors.2012 · DOI: 10.1104/pp.111.188623 Unique drought resistance functions of the highly ABA-induced clade A protein phosphatase 2Cs.2012 · DOI: 10.1104/pp.112.202408
`At3g11410`	Major negative regulator of abscisic acid (ABA) responses during seed germination and cold acclimation.	Antisense inhibition of protein phosphatase 2C accelerates cold acclimation in Arabidopsis thaliana.2001 · DOI: 10.1046/j.1365-313x.2001.01048.x Physical and functional interaction of the Arabidopsis K(+) channel AKT2 and phosphatase AtPP2CA.2002 · DOI: 10.1105/tpc.000943 ABA-hypersensitive germination3 encodes a protein phosphatase 2C (AtPP2CA) that strongly regulates abscisic acid signaling during germination among Arabidopsis protein phosphatase 2Cs.2006 · DOI: 10.1104/pp.105.070128 The protein phosphatase AtPP2CA negatively regulates abscisic acid signal transduction in Arabidopsis, and effects of abh1 on AtPP2CA mRNA.2006 · DOI: 10.1104/pp.105.070318 ABA-Hypersensitive Germination1 encodes a protein phosphatase 2C, an essential component of abscisic acid signaling in Arabidopsis seed.2007 · DOI: 10.1111/j.1365-313x.2007.03107.x ABI1 and PP2CA phosphatases are negative regulators of Snf1-related protein kinase1 signaling in Arabidopsis.2013 · DOI: 10.1105/tpc.113.114066

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035317 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009737 response to abscisic acid Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009939 positive regulation of gibberellic acid mediated signaling pathway Biological Process

GO:0010030 positive regulation of seed germination Biological Process

GO:0048838 release of seed from dormancy Biological Process

GO:1902039 negative regulation of seed dormancy process Biological Process

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G07430

ath:AT2G29380

ath:AT5G51760

dosa:Os01g0846300

dosa:Os09g0325700

osa:4346736

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.759

Rank 1 · TkA04G143180 · TK1151

Cytoplasm0.278

Rank 2 · TkA04G143180 · TK1151

Cell membrane0.068

Rank 3 · TkA04G143180 · TK1151

Endoplasmic reticulum0.035

Rank 4 · TkA04G143180 · TK1151

Mitochondrion0.024

Rank 5 · TkA04G143180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11830DUF335017-28 aa

PF02272DHHA122-71 aa

PF11830DUF335058-77 aa

PF00481PP2C81-371 aa

PF11830DUF3350137-168 aa

PF13672PP2C_2171-242 aa

PF02272DHHA1340-348 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA04G143180	`PF11830`	DUF3350	17	28	0.44	11.5
TkA04G143180	`PF02272`	DHHA1	22	71	0.013	16.6
TkA04G143180	`PF11830`	DUF3350	58	77	0.44	11.5
TkA04G143180	`PF00481`	PP2C	81	371	3.4e-56	191.5
TkA04G143180	`PF11830`	DUF3350	137	168	0.44	11.5
TkA04G143180	`PF13672`	PP2C_2	171	242	0.026	14.8
TkA04G143180	`PF02272`	DHHA1	340	348	0.013	16.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLI3`	Arabidopsis thaliana	sp\|Q9FLI3\|P2C75_ARATH Probable protein phosphatase 2C 75	48.100%	Swiss-Prot	Medium
`Q9ZW21`	Arabidopsis thaliana	sp\|Q9ZW21\|P2C24_ARATH Probable protein phosphatase 2C 24	47.700%	Swiss-Prot	Medium
`Q9LNW3`	Arabidopsis thaliana	sp\|Q9LNW3\|P2C03_ARATH Protein phosphatase 2C 3	44.200%	Swiss-Prot	Medium
`Q9FIF5`	Arabidopsis thaliana	sp\|Q9FIF5\|P2C78_ARATH Probable protein phosphatase 2C 78	47.200%	Swiss-Prot	Medium
`P49598`	Arabidopsis thaliana	sp\|P49598\|P2C37_ARATH Protein phosphatase 2C 37	46.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card