LXL04_035317 | RubberDandelionOmics

Gene overview

LXL04_035317

Reference: OH-1004 Chr: Chr08 Coordinates: 20216433-20218374 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1182 bp · LXL04_035317|LXL04_035317|OH1004|cDNA

ATGAAGCGTGTGTATGGCAGTCGCAAGAGTATGTTACCGATTGACGAGGATGCTGATTCACCCGTTAAATGCAGGGAGCGACGTCGTCGTCGGATTGAGATGAGGAGGAGGTTGTCGTCAGTTTCCGCTGTTGCCGGAACTGATAACTTCGGTGGTCCGAAGCTAGCAGCCGCGGCGGAGTTGGAGAATGAGAACGCTGAGCCGTCGATTAGGAATGAAGAAACGCCGGAGTCGCTGCTGTACGGGTCGATGTCGGTGGT...

CDS

Download CDS FASTA

1182 bp · LXL04_035317|LXL04_035317|OH1004|CDS

ATGAAGCGTGTGTATGGCAGTCGCAAGAGTATGTTACCGATTGACGAGGATGCTGATTCACCCGTTAAATGCAGGGAGCGACGTCGTCGTCGGATTGAGATGAGGAGGAGGTTGTCGTCAGTTTCCGCTGTTGCCGGAACTGATAACTTCGGTGGTCCGAAGCTAGCAGCCGCGGCGGAGTTGGAGAATGAGAACGCTGAGCCGTCGATTAGGAATGAAGAAACGCCGGAGTCGCTGCTGTACGGGTCGATGTCGGTGGT...

Protein

Download Protein FASTA

393 aa · LXL04_035317|LXL04_035317|OH1004|PROTEIN

MKRVYGSRKSMLPIDEDADSPVKCRERRRRRIEMRRRLSSVSAVAGTDNFGGPKLAAAAELENENAEPSIRNEETPESLLYGSMSVVGRAREMEDEISVQMNLCRPEINGYRPVHFFGVFDGHGGHHVSALCKENMHVIMEDELMRVKPTGDKLNRGEVEELWRTAIDRSFERMDEMALSLCQCNGLENLKMCRYHPQLSLVGSTAVVSLLTDEFIIVANCGDSRAVLCHNGKAVPLSVDHKPDRDDERNRIEASGGRII...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035317`
TK1151 ID	TkA04G143180
OH-1004 ID	LXL04_035317
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	96.900
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035317

Location Chr08:20216433-20218374 (+)

Description Similar to AHG1: Probable protein phosphatase 2C 75

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g51760`	Negative regulator of abscisic acid (ABA) responses during seed germination.	ABA-Hypersensitive Germination1 encodes a protein phosphatase 2C, an essential component of abscisic acid signaling in Arabidopsis seed.2007 · DOI: 10.1111/j.1365-313x.2007.03107.x
`At2g29380`	Probable protein phosphatase 2C 24.	No verified direct reference in this release
`At1g07430`	Involved in the negative regulation of the K(+) potassium channel AKT1 by its dephosphorylation, antagonistically to CIPK proteins (e.g. CIPK23).	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os09g0325700`	Involved in the regulation of abiotic stress responses.	A novel nuclear protein phosphatase 2C negatively regulated by ABL1 is involved in abiotic stress and panicle development in rice.2013 · DOI: 10.1007/s12033-012-9614-8 ABA inducible rice protein phosphatase 2C confers ABA insensitivity and abiotic stress tolerance in Arabidopsis.2015 · DOI: 10.1371/journal.pone.0125168
`Os01g0846300`	Probable protein phosphatase 2C 9.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035317 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0009737 response to abscisic acid Biological Process

GO:0009788 negative regulation of abscisic acid-activated signaling pathway Biological Process

GO:0009939 positive regulation of gibberellic acid mediated signaling pathway Biological Process

GO:0010030 positive regulation of seed germination Biological Process

GO:0048838 release of seed from dormancy Biological Process

GO:1902039 negative regulation of seed dormancy process Biological Process

GO:1902531 regulation of intracellular signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G07430

ath:AT2G29380

ath:AT5G51760

dosa:Os01g0846300

dosa:Os09g0325700

osa:4346736

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.755

Rank 1 · LXL04_035317 · OH-1004

Cytoplasm0.278

Rank 2 · LXL04_035317 · OH-1004

Cell membrane0.072

Rank 3 · LXL04_035317 · OH-1004

Endoplasmic reticulum0.036

Rank 4 · LXL04_035317 · OH-1004

Mitochondrion0.024

Rank 5 · LXL04_035317 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481.27PP2C81-339 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035317	`PF00481.27`	PP2C	81	339	4.2e-56	191.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLI3`	Arabidopsis thaliana	Probable protein phosphatase 2C 75	50.737%	Swiss-Prot	strong database homology
`Q9ZW21`	Arabidopsis thaliana	Probable protein phosphatase 2C 24	47.436%	Swiss-Prot	moderate database homology
`Q9LNW3`	Arabidopsis thaliana	Protein phosphatase 2C 3	44.172%	Swiss-Prot	moderate database homology
`Q0J2L7`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 68	46.885%	Swiss-Prot	moderate database homology
`Q5N9N2`	Oryza sativa subsp. japonica	Probable protein phosphatase 2C 9	43.750%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card