Gene Card
Gene overview
cDNA / CDS / Protein Sequences
3889 bp · TkA04G141670|TK1151|cDNA
TCTGAATCTCAAAACTCGGGAAAGGAAGCTCGTAATCGCGACTTGATGTGTTTCTGTAAAAACCATATGCCTACAATGGAAAGGGTTTCATGGTCTGATTCAACCCTAGGTAGAAGATTCTGCAACTGTGTAGACTCGACGAGCCCAGGAAGCCCAAGCTCATGACCACTGCACTCTTTCCCGCCAATTCTTCCCCAATCGCTGAGAAAGTTTAGGGGAGAAAGGAAGGCAGAACCGCTAGTTGTTGTTGATGATGATGA...
1824 bp · TkA04G141670|TK1151|CDS
ATGGCCGATGCTAGGGTTTTCAATGGACCCGCCGGGGCTTTGCAAGCAGGCGTCATCACCAAAATCCGGTTAGAGAACTTCATGTGCCATACTCATATGGAAATTGATATTGGCGACCGTGTCAATTTCATCACTGGACAAAACGGAAGTGGAAAGAGTGCGATACTTACGGCGTTGTGTATTGCTTTTGGATGTCGAGCAAAAAGTACAGACAGAGCAACGACATTGAAGGATTTTATAAAGACTGGTTGCAGCTACGC...
Protein
Download Protein FASTA607 aa · TkA04G141670|TK1151|PROTEIN
MADARVFNGPAGALQAGVITKIRLENFMCHTHMEIDIGDRVNFITGQNGSGKSAILTALCIAFGCRAKSTDRATTLKDFIKTGCSYALVHLEIKNQGEDAFKPTTYGDFIILERRITETTSTSVLKDWQGRKVATRREDIRELVEHFNIDVENPCVVMSQDKSREFLHSGNDKDKFKFFFKATLLSQVDDLLKSVKDNLDKANSEVVELERSIAPIEKELNELQGKIRSMEHIEEISQKVQLLTKKFAWSLVYDIDKQIH...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G141670 |
|---|---|
| TK1151 ID | TkA04G141670 |
| OH-1004 ID | LXL04_035340 |
| Relationship / confidence | Sequence Supported Annotation Or Model Conflict / Review |
| Protein identity (%) | 99.200 |
| Protein coverage (%) | TK1151 99.835 / OH-1004 55.750Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G141670 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr04:36608574-36616367 (+) | |||||||||
| Description | Similar to SMC6B: Structural maintenance of chromosomes protein 6B | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000722 telomere maintenance via recombination Biological Process GO:0000724 double-strand break repair via homologous recombination Biological Process GO:0006302 double-strand break repair Biological Process GO:0006974 DNA damage response Biological Process GO:0007062 sister chromatid cohesion Biological Process GO:0010165 response to X-ray Biological Process GO:0016925 protein sumoylation Biological Process GO:0032204 regulation of telomere maintenance Biological Process GO:0044828 host-mediated suppression of viral genome replication Biological Process GO:0051984 positive regulation of chromosome segregation Biological Process GO:0090398 cellular senescence Biological Process GO:0140588 chromatin looping Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT5G07660 ath:AT5G61460 hsa:79677 mmu:67241 xla:398986 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF02463SMC_N19-219 aaPF13175AAA_1519-400 aaPF13476AAA_2321-229 aaPF13514AAA_2721-71 aaPF13555AAA_2930-60 aaPF04310MukB33-62 aaPF13166AAA_1339-56 aaPF13191AAA_1640-60 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G141670 | PF02463 | SMC_N | 19 | 219 | 6e-10 | 39.6 |
| TkA04G141670 | PF13175 | AAA_15 | 19 | 400 | 1.1e-06 | 29.2 |
| TkA04G141670 | PF13476 | AAA_23 | 21 | 229 | 3e-16 | 61.4 |
| TkA04G141670 | PF13514 | AAA_27 | 21 | 71 | 0.7 | 10.2 |
| TkA04G141670 | PF13555 | AAA_29 | 30 | 60 | 0.00041 | 20.8 |
| TkA04G141670 | PF04310 | MukB | 33 | 62 | 7.5 | 6.9 |
| TkA04G141670 | PF13166 | AAA_13 | 39 | 56 | 5.8e-08 | 32.6 |
| TkA04G141670 | PF13191 | AAA_16 | 40 | 60 | 0.27 | 12.4 |
| TkA04G141670 | PF13304 | AAA_21 | 41 | 64 | 0.0015 | 19.2 |
| TkA04G141670 | PF00005 | ABC_tran | 41 | 60 | 0.092 | 14.1 |
| TkA04G141670 | PF03266 | NTPase_1 | 43 | 59 | 0.27 | 11.8 |
| TkA04G141670 | PF17755 | UvrA_DNA-bind | 78 | 126 | 0.033 | 15.2 |
| TkA04G141670 | PF11611 | DUF4352 | 81 | 115 | 0.039 | 15.0 |
| TkA04G141670 | PF17755 | UvrA_DNA-bind | 126 | 181 | 0.033 | 15.2 |
| TkA04G141670 | PF05478 | Prominin | 133 | 274 | 0.054 | 12.3 |
| TkA04G141670 | PF30779 | DUF8732 | 137 | 159 | 1.3 | 10.2 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.