LXL04_035340 | RubberDandelionOmics

Gene overview

LXL04_035340

Reference: OH-1004 Chr: Chr08 Coordinates: 20591779-20597467 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3264 bp · LXL04_035340|LXL04_035340|OH1004|cDNA

ATGGCCGATGCTAGGGTTTTCAATGGACCCGCCGGGGCTTTGCAAGCAGGCGTCATCACCAAAATCCGGTTAGAGAACTTCATGTGCCATACTCATATGGAAATTGATATTGGCGACCGTGTCAATTTCATCACTGGACAAAACGGAAGTGGAAAGAGTGCGATACTTACGGCGTTGTGTATTGCTTTTGGATGTCGAGCAAAAAGTACAGACAGAGCAACGACATTGAAGGATTTTATAAAGACTGGTTGCAGCTACGC...

CDS

Download CDS FASTA

3264 bp · LXL04_035340|LXL04_035340|OH1004|CDS

ATGGCCGATGCTAGGGTTTTCAATGGACCCGCCGGGGCTTTGCAAGCAGGCGTCATCACCAAAATCCGGTTAGAGAACTTCATGTGCCATACTCATATGGAAATTGATATTGGCGACCGTGTCAATTTCATCACTGGACAAAACGGAAGTGGAAAGAGTGCGATACTTACGGCGTTGTGTATTGCTTTTGGATGTCGAGCAAAAAGTACAGACAGAGCAACGACATTGAAGGATTTTATAAAGACTGGTTGCAGCTACGC...

Protein

Download Protein FASTA

1087 aa · LXL04_035340|LXL04_035340|OH1004|PROTEIN

MADARVFNGPAGALQAGVITKIRLENFMCHTHMEIDIGDRVNFITGQNGSGKSAILTALCIAFGCRAKSTDRATTLKDFIKTGCSYALVHLEIKNQGEDAFKPTTYGDFIILERRITETTSTSVLKDWQGRKVATRREDIRELVEHFNIDVENPCVVMSQDKSREFLHSGNDKDKFKFFFKATLLSQVDDLLKSVKDNLDKANSEVVELERSIAPIEKELNELQGKIRSMEHIEEISQKVQLLTKKFAWSLVYDIDKQIH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035340`
TK1151 ID	TkA04G141670
OH-1004 ID	LXL04_035340
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.200
Protein coverage (%)	TK1151 99.835 / OH-1004 55.750 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035340

Location Chr08:20591779-20597467 (-)

Description Similar to SMC6B: Structural maintenance of chromosomes protein 6B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g61460`	Core component of the SMC5-SMC6 complex that promotes sister chromatid alignment after DNA damage and facilitates double-stranded DNA breaks (DSBs) repair via homologous recombination between sister chromatids.	No verified direct reference in this release
`At5g07660`	Core component of the SMC5-SMC6 complex that promotes sister chromatid alignment after DNA damage and facilitates double-stranded DNA breaks (DSBs) repair via homologous recombination between sister chromatids.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035340 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000722 telomere maintenance via recombination Biological Process

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007062 sister chromatid cohesion Biological Process

GO:0010165 response to X-ray Biological Process

GO:0016925 protein sumoylation Biological Process

GO:0032204 regulation of telomere maintenance Biological Process

GO:0044828 host-mediated suppression of viral genome replication Biological Process

GO:0051984 positive regulation of chromosome segregation Biological Process

GO:0090398 cellular senescence Biological Process

GO:0140588 chromatin looping Biological Process

KEGG gene cross-reference

ath:AT5G07660

ath:AT5G61460

hsa:79677

mmu:67241

xla:398986

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.914

Rank 1 · LXL04_035340 · OH-1004

Cytoplasm0.179

Rank 2 · LXL04_035340 · OH-1004

Mitochondrion0.028

Rank 3 · LXL04_035340 · OH-1004

Cell membrane0.018

Rank 4 · LXL04_035340 · OH-1004

Endoplasmic reticulum0.009

Rank 5 · LXL04_035340 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02463.26SMC_N19-1077 aa

PF13476.13AAA_2321-229 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035340	`PF02463.26`	SMC_N	19	1077	1.8e-25	90.4
LXL04_035340	`PF13476.13`	AAA_23	21	229	4.4e-19	70.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FII7`	Arabidopsis thaliana	Structural maintenance of chromosomes protein 6B	56.530%	Swiss-Prot	strong database homology
`Q9FLR5`	Arabidopsis thaliana	Structural maintenance of chromosomes protein 6A	55.784%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card