RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G121590
Reference: TK1151 Chr: Chr04 Coordinates: 31588487-31591263 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1845 bp · TkA04G121590|TK1151|cDNA

GAAAGTTGTATGATTGAACGATATTTTCCTTTTATTCGGGGCAATTGACGTAGTTACTTGGAACCACCCGAAATCACATATTTCTCTCTCGCAACTCCTAACTAGAATCCCATTAGGCCATAACACAACCCGCGAACAAAACAGGATTACGCGGTTTACACATCTGCCTTCCAATATAACTTCCCTCTCTCGATCCCAAAGCTTCGTTGACCCGAAATCTCCCAGTCTCGTTCTTGATTCCCACTTTTTTCAGATCAGTC...

CDS

Download CDS FASTA

1308 bp · TkA04G121590|TK1151|CDS

ATGTACAGCAATTTTAAGGAACAGGCAATTGTGTATGTAAAGCAAGCAGTTGAAGAAGACACAGCTGGTAACTATGCAAAGGCGTTTACACTATACATGAACGCATTAGAATACTTCAAGACTCATTTGAAGTACGAAAAGAATCCGAAGCTTAAAGAAGCAATCACCCAAAAATTCACGGATTATCTGAGGAGGGCTGAGGAAATTAGGGCTGTTCTTGAGGATGGAGGAGGGAATAAACCGTCATCAAATGGAGGAGA...

Protein

Download Protein FASTA

435 aa · TkA04G121590|TK1151|PROTEIN

MYSNFKEQAIVYVKQAVEEDTAGNYAKAFTLYMNALEYFKTHLKYEKNPKLKEAITQKFTDYLRRAEEIRAVLEDGGGNKPSSNGGDTGVATRPKSNKKNGDGDGGDDSEQSKLRSGLNSAIIREKPNVKWNDVAGLQSAKQALQEAVILPVKFPQFFVGKRRPWRAFLLYGPPGTGKSYLAKAVATEADSTFFSISSSDLVSKWMGESEKLVSNLFQMARESAPSIIFIDEIDSLVGQRGEGNESEASRRIKTELLVQM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G121590
TK1151 IDTkA04G121590
OH-1004 IDLXL04_035595
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)92.400
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G121590
LocationChr04:31588487-31591263 (-)
DescriptionSimilar to SKD1: Protein SUPPRESSOR OF K(+) TRANSPORT GROWTH DEFECT 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g27600 Involved in the transport of biosynthetic membrane proteins from the prevacuolar/endosomal compartment to the vacuole.
The Arabidopsis AAA ATPase SKD1 is involved in multivesicular endosome function and interacts with its positive regulator LYST-INTERACTING PROTEIN5.2007 · DOI: 10.1105/tpc.106.049346
The AAA-type ATPase AtSKD1 contributes to vacuolar maintenance of Arabidopsis thaliana.2010 · DOI: 10.1111/j.1365-313x.2010.04310.x
Seeds of Arabidopsis plants expressing dominant-negative AtSKD1 under control of the GL2 promoter show a transparent testa phenotype and a mucilage defect.2010 · DOI: 10.4161/psb.5.10.13134
The Arabidopsis deubiquitinating enzyme AMSH3 interacts with ESCRT-III subunits and regulates their localization.2011 · DOI: 10.1105/tpc.111.087254
Artificial ubiquitylation is sufficient for sorting of a plasma membrane ATPase to the vacuolar lumen of Arabidopsis cells.2012 · DOI: 10.1007/s00425-012-1587-0
Suppressor of K+ transport growth defect 1 (SKD1) interacts with RING-type ubiquitin ligase and sucrose non-fermenting 1-related protein kinase (SnRK1) in the halophyte ice plant.2013 · DOI: 10.1093/jxb/ert097
A novel endosomal sorting complex required for transport (ESCRT) component in Arabidopsis thaliana controls cell expansion and development.2014 · DOI: 10.1074/jbc.m113.529685
The Arabidopsis Endosomal Sorting Complex Required for Transport III Regulates Internal Vesicle Formation of the Prevacuolar Compartment and Is Required for Plant Development.2014 · DOI: 10.1104/pp.114.238378

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_035595 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006623 protein targeting to vacuole Biological Process
GO:0006914 autophagy Biological Process
GO:0006997 nucleus organization Biological Process
GO:0007032 endosome organization Biological Process
GO:0007033 vacuole organization Biological Process
GO:0007080 mitotic metaphase chromosome alignment Biological Process
GO:0009306 protein secretion Biological Process
GO:0010091 trichome branching Biological Process
GO:0010824 regulation of centrosome duplication Biological Process
GO:0010971 positive regulation of G2/M transition of mitotic cell cycle Biological Process
GO:0015031 protein transport Biological Process
GO:0016125 sterol metabolic process Biological Process
KEGG gene cross-reference
ath:AT2G27600
bta:539357
cal:CAALFM_C503090WA
hsa:9525
sce:YPR173C
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.668
Rank 1 · TkA04G121590 · TK1151
Nucleus0.289
Rank 2 · TkA04G121590 · TK1151
Cell membrane0.114
Rank 3 · TkA04G121590 · TK1151
Endoplasmic reticulum0.068
Rank 4 · TkA04G121590 · TK1151
Lysosome / Vacuole0.066
Rank 5 · TkA04G121590 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13521AAA_285-66 aa
PF04212MIT7-70 aa
PF13479AAA_2410-43 aa
PF08969USP8_dimer13-75 aa
PF01637ATPase_214-59 aa
PF05673DUF815123-232 aa
PF25199nSTAND_NTPase5131-239 aa
PF13191AAA_16162-197 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G121590PF13521AAA_285660.07114.0
TkA04G121590PF04212MIT7701.9e-1970.2
TkA04G121590PF13479AAA_2410430.02415.1
TkA04G121590PF08969USP8_dimer13750.1513.0
TkA04G121590PF01637ATPase_214590.09113.3
TkA04G121590PF05673DUF8151232320.00218.1
TkA04G121590PF25199nSTAND_NTPase51312390.09813.2
TkA04G121590PF13191AAA_161621971.8e-0526.1
TkA04G121590PF01637ATPase_21621890.09113.3
TkA04G121590PF06068TIP491652160.0002820.9
TkA04G121590PF13173AAA_141662360.0001822.2
TkA04G121590PF07724AAA_21662340.003318.2
TkA04G121590PF24883NPHP3_N1661910.003318.3
TkA04G121590PF06745ATPase1661830.2411.4
TkA04G121590PF01057Parvo_NS11671870.0712.8
TkA04G121590PF12775AAA_71671950.09113.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9ZNT0Arabidopsis thalianasp|Q9ZNT0|VPS4_ARATH Protein SUPPRESSOR OF K(+) TRANSPORT GROWTH DEFECT 184.200%Swiss-ProtHigh

JBrowse

View in Genome Browser