LXL04_035595 | RubberDandelionOmics

Gene overview

LXL04_035595

Reference: OH-1004 Chr: Chr08 Coordinates: 25184037-25186123 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1209 bp · LXL04_035595|LXL04_035595|OH1004|cDNA

ATGTACAGCAATTTTAAGGAACAAGCTATCGTATATGTAAAGCAAGCAGTTGAAGAAGACACAGCTGGTAACTATGCAAAGGCGTTTACACTTTACATGAACGCATTAGAATACTTCAAGACTCATTTGAAGTACGAAAAGAATCCGAAGCTTAAAGAAGCAATCACCCAAAAATTCACGGATTATCTGAGGAGGGCTGAGGAAATTAGGGCTGTTCTTGAGGACGGAGGAGGGAATAAACCGTCATCAAATGGAGGAGA...

CDS

Download CDS FASTA

1209 bp · LXL04_035595|LXL04_035595|OH1004|CDS

ATGTACAGCAATTTTAAGGAACAAGCTATCGTATATGTAAAGCAAGCAGTTGAAGAAGACACAGCTGGTAACTATGCAAAGGCGTTTACACTTTACATGAACGCATTAGAATACTTCAAGACTCATTTGAAGTACGAAAAGAATCCGAAGCTTAAAGAAGCAATCACCCAAAAATTCACGGATTATCTGAGGAGGGCTGAGGAAATTAGGGCTGTTCTTGAGGACGGAGGAGGGAATAAACCGTCATCAAATGGAGGAGA...

Protein

Download Protein FASTA

402 aa · LXL04_035595|LXL04_035595|OH1004|PROTEIN

MYSNFKEQAIVYVKQAVEEDTAGNYAKAFTLYMNALEYFKTHLKYEKNPKLKEAITQKFTDYLRRAEEIRAVLEDGGGNKPSSNGGDTGVATRPKSNKKNGDGDGGDDSEQSKLRSGLNSAIIREKPNVKWNDVAGLQSAKQALQEAVILPVKFPQFFVGKRRPWRAFLLYGPPGTGKSYLAKAVATEADSTFFSISSSDLVSKWMGESEKLVSNLFQMARESAPSIIFIDEIDSLVGQRGEGNESEASRRIKTELLVQM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035595`
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035595

Location Chr08:25184037-25186123 (+)

Description Similar to SKD1: Protein SUPPRESSOR OF K(+) TRANSPORT GROWTH DEFECT 1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g27600`	Involved in the transport of biosynthetic membrane proteins from the prevacuolar/endosomal compartment to the vacuole.	The Arabidopsis AAA ATPase SKD1 is involved in multivesicular endosome function and interacts with its positive regulator LYST-INTERACTING PROTEIN5.2007 · DOI: 10.1105/tpc.106.049346 The AAA-type ATPase AtSKD1 contributes to vacuolar maintenance of Arabidopsis thaliana.2010 · DOI: 10.1111/j.1365-313x.2010.04310.x Seeds of Arabidopsis plants expressing dominant-negative AtSKD1 under control of the GL2 promoter show a transparent testa phenotype and a mucilage defect.2010 · DOI: 10.4161/psb.5.10.13134 The Arabidopsis deubiquitinating enzyme AMSH3 interacts with ESCRT-III subunits and regulates their localization.2011 · DOI: 10.1105/tpc.111.087254 Artificial ubiquitylation is sufficient for sorting of a plasma membrane ATPase to the vacuolar lumen of Arabidopsis cells.2012 · DOI: 10.1007/s00425-012-1587-0 Suppressor of K+ transport growth defect 1 (SKD1) interacts with RING-type ubiquitin ligase and sucrose non-fermenting 1-related protein kinase (SnRK1) in the halophyte ice plant.2013 · DOI: 10.1093/jxb/ert097 A novel endosomal sorting complex required for transport (ESCRT) component in Arabidopsis thaliana controls cell expansion and development.2014 · DOI: 10.1074/jbc.m113.529685 The Arabidopsis Endosomal Sorting Complex Required for Transport III Regulates Internal Vesicle Formation of the Prevacuolar Compartment and Is Required for Plant Development.2014 · DOI: 10.1104/pp.114.238378

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035595 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006623 protein targeting to vacuole Biological Process

GO:0006914 autophagy Biological Process

GO:0006997 nucleus organization Biological Process

GO:0007032 endosome organization Biological Process

GO:0007033 vacuole organization Biological Process

GO:0007080 mitotic metaphase chromosome alignment Biological Process

GO:0009306 protein secretion Biological Process

GO:0010091 trichome branching Biological Process

GO:0010824 regulation of centrosome duplication Biological Process

GO:0010971 positive regulation of G2/M transition of mitotic cell cycle Biological Process

GO:0015031 protein transport Biological Process

GO:0016125 sterol metabolic process Biological Process

KEGG gene cross-reference

ath:AT2G27600

bta:539357

cal:CAALFM_C503090WA

hsa:9525

sce:YPR173C

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.628

Rank 1 · LXL04_035595 · OH-1004

Nucleus0.303

Rank 2 · LXL04_035595 · OH-1004

Peroxisome0.093

Rank 3 · LXL04_035595 · OH-1004

Cell membrane0.091

Rank 4 · LXL04_035595 · OH-1004

Mitochondrion0.088

Rank 5 · LXL04_035595 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04212.25MIT7-70 aa

PF07728.21AAA_5168-290 aa

PF00004.36AAA169-298 aa

PF09336.17Vps4_C335-399 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035595	`PF04212.25`	MIT	7	70	1.7e-19	70.4
LXL04_035595	`PF07728.21`	AAA_5	168	290	5.3e-06	27.2
LXL04_035595	`PF00004.36`	AAA	169	298	8.3e-45	153.2
LXL04_035595	`PF09336.17`	Vps4_C	335	399	8.4e-22	77.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZNT0`	Arabidopsis thaliana	Protein SUPPRESSOR OF K(+) TRANSPORT GROWTH DEFECT 1	78.032%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card