RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G117960
Reference: TK1151 Chr: Chr04 Coordinates: 30677346-30680855 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2264 bp · TkA04G117960|TK1151|cDNA

AAACGAAGGGGTAAAACTGCGAACAATATGTTCACCTCGCTTCAAATCAGAATTTCAAAATTAGCGGGAGTAGTTCTTCACAATCTCAGGTTCATTCTAGTATTCGACCATGCCTGCCATCAGGATGATATAACCTCTGAGTCATAGAATTTATCGAAAATATTCAATCTTACGCCTGTTCTTCTCAACATGGAACAAAATTTGCCCTAGATTCTCCTATCGAAATTCCTAATTCCAAAACCCTAAATCGACAGAGAATG...

CDS

Download CDS FASTA

1887 bp · TkA04G117960|TK1151|CDS

ATGGAGAGAGTAGTGTGTCCCGAAAATACGGAGCTTGTTGAGTTCATGTTGAAAAAACAAAAGGAATTGGTGGATTTATCGGAGAATAACTCCAAGACGATATCGAAAGCCTGCTTGAAGGTGTGCAGTTCCAAGACCCCAATCAAAACCCTCAAGGACTTCTCCAATGTCAAAGGTGTGGGAAAGTGGATTTTGAGAATCATGAAAGATTTCTTCACTGATGAAGCTGAGAACGAAGACATAATAGAAAGCAGTAAGAG...

Protein

Download Protein FASTA

628 aa · TkA04G117960|TK1151|PROTEIN

MERVVCPENTELVEFMLKKQKELVDLSENNSKTISKACLKVCSSKTPIKTLKDFSNVKGVGKWILRIMKDFFTDEAENEDIIESSKRNKGNKQYVPQKNSAAYALLITLYRGTSNGIEFMRKQELMEAAQASGLSRSPIMPEIGKGKAGQFGVSSGRDWYSGWSCMKKLLDKGLAVKSSNPAKYMLTEQGKEAARDCMLRSGLVDSTESLATVELNQNNIRDSVRTNAELADDVASRHVSSSSQKRPVVIPPDTLDKLVR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G117960
TK1151 IDTkA04G117960
OH-1004 IDLXL04_035633
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)97.500
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G117960
LocationChr04:30677346-30680855 (+)
DescriptionSimilar to MUS81: Crossover junction endonuclease MUS81
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g30870 Interacts with EME1 to form a DNA structure-specific endonuclease with substrate preference for branched DNA structures with a 5'-end at the branch nick.
The role of AtMUS81 in DNA repair and its genetic interaction with the helicase AtRecQ4A.2006 · DOI: 10.1093/nar/gkl576
The role of AtMUS81 in interference-insensitive crossovers in A. thaliana.2007 · DOI: 10.1371/journal.pgen.0030132
Expression and functional analysis of AtMUS81 in Arabidopsis meiosis reveals a role in the second pathway of crossing-over.2008 · DOI: 10.1111/j.1365-313x.2008.03403.x
Two distinct MUS81-EME1 complexes from Arabidopsis process Holliday junctions.2009 · DOI: 10.1104/pp.109.136846
RAD5A, RECQ4A, and MUS81 have specific functions in homologous recombination and define different pathways of DNA repair in Arabidopsis thaliana.2010 · DOI: 10.1105/tpc.110.078568
The Structure-Specific Endonucleases MUS81 and SEND1 Are Essential for Telomere Stability in Arabidopsis.2016 · DOI: 10.1105/tpc.15.00898

Rice

Reference gene IDPossible functionPapers / DOI
Os01g0948100 Interacts with EME1 to form a DNA structure-specific endonuclease with substrate preference for branched DNA structures with a 5'-end at the branch nick. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_035633 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0000712 resolution of meiotic recombination intermediates Biological Process
GO:0000723 telomere maintenance Biological Process
GO:0000724 double-strand break repair via homologous recombination Biological Process
GO:0000727 double-strand break repair via break-induced replication Biological Process
GO:0006265 DNA topological change Biological Process
GO:0006281 DNA repair Biological Process
GO:0006308 DNA catabolic process Biological Process
GO:0006312 mitotic recombination Biological Process
GO:0006974 DNA damage response Biological Process
GO:0007129 homologous chromosome pairing at meiosis Biological Process
GO:0031297 replication fork processing Biological Process
GO:0031573 mitotic intra-S DNA damage checkpoint signaling Biological Process
KEGG gene cross-reference
ath:AT4G30870
dha:DEHA2G05214g
dosa:Os01g0948100
dre:406839
kla:KLLA0_E03015g
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.873
Rank 1 · TkA04G117960 · TK1151
Cytoplasm0.193
Rank 2 · TkA04G117960 · TK1151
Mitochondrion0.035
Rank 3 · TkA04G117960 · TK1151
Cell membrane0.025
Rank 4 · TkA04G117960 · TK1151
Endoplasmic reticulum0.013
Rank 5 · TkA04G117960 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02732ERCC480-107 aa
PF21136WHD_MUS8196-194 aa
PF20008DUF6429162-198 aa
PF02732ERCC4212-260 aa
PF00627UBA252-271 aa
PF07223DUF1421254-268 aa
PF02732ERCC4388-511 aa
PF21292EME1-MUS81_C388-403 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G117960PF02732ERCC4801071e-2487.8
TkA04G117960PF21136WHD_MUS81961942.6e-1247.7
TkA04G117960PF20008DUF64291621980.1112.9
TkA04G117960PF02732ERCC42122601e-2487.8
TkA04G117960PF00627UBA2522710.03814.6
TkA04G117960PF07223DUF14212542680.1712.5
TkA04G117960PF02732ERCC43885111e-2487.8
TkA04G117960PF21292EME1-MUS81_C3884033.9e-0627.7
TkA04G117960PF21292EME1-MUS81_C4935153.9e-0627.7
TkA04G117960PF21292EME1-MUS81_C5585983.9e-0627.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q5W9E7Arabidopsis thalianasp|Q5W9E7|MUS81_ARATH Crossover junction endonuclease MUS8151.000%Swiss-ProtHigh
Q8GT06Oryza sativa subsp. japonicasp|Q8GT06|MUS81_ORYSJ Crossover junction endonuclease MUS8144.500%Swiss-ProtMedium

JBrowse

View in Genome Browser