LXL04_035633 | RubberDandelionOmics

Gene overview

LXL04_035633

Reference: OH-1004 Chr: Chr08 Coordinates: 25965489-25968626 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1896 bp · LXL04_035633|LXL04_035633|OH1004|cDNA

ATGGAGAGAGTAGTGTGTCCCGAAAATACGGAGCTTGTTGAGTTCATGTTGAAAAAACAAAAGGAATTGGTGGATTTATCGGAGAATAACTCCAAGACGATATCGAAAGCCTGCTTGAAGGTGTGCAGTTCCAAGACCCCAATCAAAACCCTCAAGGACTTCTCCAATGTCAAAGGTGTGGGAAAGTGGATTTTGAGAATCATGAAAGATTTCTTCACTGATGAAGCTGAGAACGAAGACATAATAGAAAGCAGTAAGAG...

CDS

Download CDS FASTA

1896 bp · LXL04_035633|LXL04_035633|OH1004|CDS

ATGGAGAGAGTAGTGTGTCCCGAAAATACGGAGCTTGTTGAGTTCATGTTGAAAAAACAAAAGGAATTGGTGGATTTATCGGAGAATAACTCCAAGACGATATCGAAAGCCTGCTTGAAGGTGTGCAGTTCCAAGACCCCAATCAAAACCCTCAAGGACTTCTCCAATGTCAAAGGTGTGGGAAAGTGGATTTTGAGAATCATGAAAGATTTCTTCACTGATGAAGCTGAGAACGAAGACATAATAGAAAGCAGTAAGAG...

Protein

Download Protein FASTA

631 aa · LXL04_035633|LXL04_035633|OH1004|PROTEIN

MERVVCPENTELVEFMLKKQKELVDLSENNSKTISKACLKVCSSKTPIKTLKDFSNVKGVGKWILRIMKDFFTDEAENEDIIESSKRNKGNKQYVPQKNSAAYALLITLYRGTSNGIEFMRKQELMEAAEASGLSRSPIMPEIGKGKAGQFGVSSGRDWYSGWSCMKKLLDKGLAVKSSNPAKYMLTEQGKEAARDCMLRSGLVDSTESLATVDLNQNNIRDSVRTNAELADDVASSHVTSSSQKRPVVIPPDTLDKLVR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035633`
TK1151 ID	TkA04G117960
OH-1004 ID	LXL04_035633
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	97.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035633

Location Chr08:25965489-25968626 (-)

Description Similar to MUS81: Crossover junction endonuclease MUS81

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g30870`	Interacts with EME1 to form a DNA structure-specific endonuclease with substrate preference for branched DNA structures with a 5'-end at the branch nick.	The role of AtMUS81 in DNA repair and its genetic interaction with the helicase AtRecQ4A.2006 · DOI: 10.1093/nar/gkl576 The role of AtMUS81 in interference-insensitive crossovers in A. thaliana.2007 · DOI: 10.1371/journal.pgen.0030132 Expression and functional analysis of AtMUS81 in Arabidopsis meiosis reveals a role in the second pathway of crossing-over.2008 · DOI: 10.1111/j.1365-313x.2008.03403.x Two distinct MUS81-EME1 complexes from Arabidopsis process Holliday junctions.2009 · DOI: 10.1104/pp.109.136846 RAD5A, RECQ4A, and MUS81 have specific functions in homologous recombination and define different pathways of DNA repair in Arabidopsis thaliana.2010 · DOI: 10.1105/tpc.110.078568 The Structure-Specific Endonucleases MUS81 and SEND1 Are Essential for Telomere Stability in Arabidopsis.2016 · DOI: 10.1105/tpc.15.00898

Rice

Reference gene ID	Possible function	Papers / DOI
`Os01g0948100`	Interacts with EME1 to form a DNA structure-specific endonuclease with substrate preference for branched DNA structures with a 5'-end at the branch nick.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035633 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000712 resolution of meiotic recombination intermediates Biological Process

GO:0000723 telomere maintenance Biological Process

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0000727 double-strand break repair via break-induced replication Biological Process

GO:0006265 DNA topological change Biological Process

GO:0006281 DNA repair Biological Process

GO:0006308 DNA catabolic process Biological Process

GO:0006312 mitotic recombination Biological Process

GO:0006974 DNA damage response Biological Process

GO:0007129 homologous chromosome pairing at meiosis Biological Process

GO:0031297 replication fork processing Biological Process

GO:0031573 mitotic intra-S DNA damage checkpoint signaling Biological Process

KEGG gene cross-reference

ath:AT4G30870

dha:DEHA2G05214g

dosa:Os01g0948100

dre:406839

kla:KLLA0_E03015g

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.881

Rank 1 · LXL04_035633 · OH-1004

Cytoplasm0.191

Rank 2 · LXL04_035633 · OH-1004

Mitochondrion0.037

Rank 3 · LXL04_035633 · OH-1004

Cell membrane0.024

Rank 4 · LXL04_035633 · OH-1004

Endoplasmic reticulum0.012

Rank 5 · LXL04_035633 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF21136.3WHD_MUS8196-194 aa

PF02732.22ERCC4413-514 aa

PF21292.4EME1-MUS81_C561-601 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035633	`PF21136.3`	WHD_MUS81	96	194	6.8e-12	46.3
LXL04_035633	`PF02732.22`	ERCC4	413	514	9.4e-22	78.2
LXL04_035633	`PF21292.4`	EME1-MUS81_C	561	601	3.8e-06	27.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q5W9E7`	Arabidopsis thaliana	Crossover junction endonuclease MUS81	50.669%	Swiss-Prot	strong database homology
`Q8GT06`	Oryza sativa subsp. japonica	Crossover junction endonuclease MUS81	44.978%	Swiss-Prot	moderate database homology

JBrowse

View in Genome Browser

Gene Card