Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1891 bp · TkA04G098760|TK1151|cDNA
GTTATGGAAGCGTAGCAAAGATAATATATGAAAAAAGCCCATACTTTACCCTGACTTTACCCTGTTATCAATTGAAGCAAAGTCAAAAACATTGAAGATCGTAACTAGGGCGAAGTCCCCACCCAATACGATTCCCGGTTAGACACTCTCTCTTTGCCGCTTCCAGCTTCGGCTGACTTCGTTTATCGTCTTCAGGATAATTTGAAATGGCAGAGCCTTCTAAAGTCATCCACGTTCGGAATGTTGGCCATGAGATTTCA...
1047 bp · TkA04G098760|TK1151|CDS
ATGATGGGGTGCGATTGGACGCGGTATGGAATACAGCCTAACCGTATACTCCTGGTTACAATCCACCACATGCTCTACCCTATTACAGTGGAAGTCCTGCATCAAGTCTTTTCTCCTCATGGCCACGTGGAGAAAATTGTCACTTTCCAAAAGTCAGCTGGTTTTCAAGCACTTATTCAATTTAATTCGCGCCAGAGTGCTGTGGCTGCTAGAAATTCACTTCAGGGGCGTAATATATACGATGGTTGTTGCCAGCTGGA...
Protein
Download Protein FASTA348 aa · TkA04G098760|TK1151|PROTEIN
MMGCDWTRYGIQPNRILLVTIHHMLYPITVEVLHQVFSPHGHVEKIVTFQKSAGFQALIQFNSRQSAVAARNSLQGRNIYDGCCQLDIQFSNLEELQVNYNNERSRDFTNPSLPSEQKGRPSQPGYGDAGVGFPQMNNAAAIAAAFGGGLPPGISGTNERCTVLASNLNPDRIDEDKLFNLFSLYGNIVRIKLLRNKPDHALVQMGDGFQSELAVHFLKGATLFGKRLEVNFSKHSNITMGAETHEYLNSNLNRFNRNAA...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G098760 |
|---|---|
| TK1151 ID | TkA04G098760 |
| OH-1004 ID | LXL04_035891 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 99.400 |
| Protein coverage (%) | TK1151 97.414 / OH-1004 78.472Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G098760 | ||||||
|---|---|---|---|---|---|---|---|
| Location | Chr04:25743704-25747429 (+) | ||||||
| Description | Similar to At1g43190: Polypyrimidine tract-binding protein homolog 3 | ||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | ||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||
| GO annotations (OH1004 source) | GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process GO:0000956 nuclear-transcribed mRNA catabolic process Biological Process GO:0006397 mRNA processing Biological Process GO:0006417 regulation of translation Biological Process GO:0008380 RNA splicing Biological Process GO:0033119 negative regulation of RNA splicing Biological Process GO:0043484 regulation of RNA splicing Biological Process GO:0045595 regulation of cell differentiation Biological Process GO:0045727 positive regulation of translation Biological Process GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process GO:0048025 negative regulation of mRNA splicing, via spliceosome Biological Process GO:0070935 3'-UTR-mediated mRNA stabilization Biological Process | ||||||
| KEGG gene cross-reference | ath:AT1G43190 hsa:5725 mmu:19205 rno:29497 ssc:397461 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF13893RRM_514-96 aaPF11835RRM_814-91 aaPF28976RRM_ACIN119-77 aaPF00076RRM_127-81 aaPF22976RRM_1028-70 aaPF17797RL29-67 aaPF16842RRM_occluded31-79 aaPF23085RRM_PARP14_338-65 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G098760 | PF13893 | RRM_5 | 14 | 96 | 4.4e-38 | 130.5 |
| TkA04G098760 | PF11835 | RRM_8 | 14 | 91 | 4.7e-23 | 81.9 |
| TkA04G098760 | PF28976 | RRM_ACIN1 | 19 | 77 | 8.9e-07 | 29.6 |
| TkA04G098760 | PF00076 | RRM_1 | 27 | 81 | 5.7e-23 | 81.3 |
| TkA04G098760 | PF22976 | RRM_10 | 28 | 70 | 1.7e-05 | 25.6 |
| TkA04G098760 | PF17797 | RL | 29 | 67 | 4.6e-05 | 24.0 |
| TkA04G098760 | PF16842 | RRM_occluded | 31 | 79 | 2.7e-08 | 34.3 |
| TkA04G098760 | PF23085 | RRM_PARP14_3 | 38 | 65 | 0.0077 | 17.0 |
| TkA04G098760 | PF25015 | RBD_AKAP-17A | 43 | 79 | 0.14 | 12.3 |
| TkA04G098760 | PF28441 | RRM_11 | 56 | 70 | 0.17 | 13.0 |
| TkA04G098760 | PF13893 | RRM_5 | 145 | 246 | 4.4e-38 | 130.5 |
| TkA04G098760 | PF16367 | RRM_7 | 146 | 155 | 0.062 | 14.0 |
| TkA04G098760 | PF23085 | RRM_PARP14_3 | 163 | 196 | 0.0077 | 17.0 |
| TkA04G098760 | PF00076 | RRM_1 | 166 | 228 | 5.7e-23 | 81.3 |
| TkA04G098760 | PF17797 | RL | 169 | 189 | 4.6e-05 | 24.0 |
| TkA04G098760 | PF16842 | RRM_occluded | 170 | 227 | 2.7e-08 | 34.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
| Protein | Organism | Description | Identity | Database | Confidence |
|---|---|---|---|---|---|
Q6ICX4 | Arabidopsis thaliana | sp|Q6ICX4|PTBP3_ARATH Polypyrimidine tract-binding protein homolog 3 | 83.100% | Swiss-Prot | High |