LXL04_035891 | RubberDandelionOmics

Gene overview

LXL04_035891

Reference: OH-1004 Chr: Chr08 Coordinates: 31506097-31509142 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1299 bp · LXL04_035891|LXL04_035891|OH1004|cDNA

ATGGCAGAGCCTTCTAAAGTCATCCACGTTCGGAATGTTGGCCATGAGATTTCAGAGCCTGATCTTCTTCAGCTATTCCAACCTTTTGGAGTGATCAACAAACTAGTCATGCTTCGTGCAAAAAACCAGGCTCTCCTTCAAATGCAAGACGTTCCTTCAGCCATTAATGCAATGCAATTCTATGCCAATGTTCAACCAAGCATAAGGGGAAGAAATGTTTATGTCCAGTTTTCATCTCACCAAGAACTTACCACCATGGA...

CDS

Download CDS FASTA

1299 bp · LXL04_035891|LXL04_035891|OH1004|CDS

ATGGCAGAGCCTTCTAAAGTCATCCACGTTCGGAATGTTGGCCATGAGATTTCAGAGCCTGATCTTCTTCAGCTATTCCAACCTTTTGGAGTGATCAACAAACTAGTCATGCTTCGTGCAAAAAACCAGGCTCTCCTTCAAATGCAAGACGTTCCTTCAGCCATTAATGCAATGCAATTCTATGCCAATGTTCAACCAAGCATAAGGGGAAGAAATGTTTATGTCCAGTTTTCATCTCACCAAGAACTTACCACCATGGA...

Protein

Download Protein FASTA

432 aa · LXL04_035891|LXL04_035891|OH1004|PROTEIN

MAEPSKVIHVRNVGHEISEPDLLQLFQPFGVINKLVMLRAKNQALLQMQDVPSAINAMQFYANVQPSIRGRNVYVQFSSHQELTTMEQNTQGRGDEPNRILLVTIHHMLYPITVEVLHQVFSPHGHVEKIVTFQKSAGFQALIQFNSRQSAVAARNSLQGRNIYDGCCQLDIQFSNLEELQVNYNNERSRDFTNPSLPSEQKGRPSQPGYGDAGVGFPQMNNAAAIAAAFGGGLPPGISGTNERCTVLASNLNPDRIDED...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_035891`
TK1151 ID	TkA04G098760
OH-1004 ID	LXL04_035891
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	99.400
Protein coverage (%)	TK1151 97.414 / OH-1004 78.472 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_035891

Location Chr08:31506097-31509142 (-)

Description Similar to At1g43190: Polypyrimidine tract-binding protein homolog 3

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g43190`	Plays a role in pre-mRNA splicing.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_035891 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0000381 regulation of alternative mRNA splicing, via spliceosome Biological Process

GO:0000956 nuclear-transcribed mRNA catabolic process Biological Process

GO:0006397 mRNA processing Biological Process

GO:0006417 regulation of translation Biological Process

GO:0008380 RNA splicing Biological Process

GO:0033119 negative regulation of RNA splicing Biological Process

GO:0043484 regulation of RNA splicing Biological Process

GO:0045595 regulation of cell differentiation Biological Process

GO:0045727 positive regulation of translation Biological Process

GO:0045944 positive regulation of transcription by RNA polymerase II Biological Process

GO:0048025 negative regulation of mRNA splicing, via spliceosome Biological Process

GO:0070935 3'-UTR-mediated mRNA stabilization Biological Process

KEGG gene cross-reference

ath:AT1G43190

hsa:5725

mmu:19205

rno:29497

ssc:397461

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.678

Rank 1 · LXL04_035891 · OH-1004

Nucleus0.453

Rank 2 · LXL04_035891 · OH-1004

Cell membrane0.074

Rank 3 · LXL04_035891 · OH-1004

Lysosome / Vacuole0.034

Rank 4 · LXL04_035891 · OH-1004

Mitochondrion0.032

Rank 5 · LXL04_035891 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF13893.13RRM_55-97 aa

PF00076.29RRM_19-59 aa

PF11835.15RRM_896-175 aa

PF00076.29RRM_1111-165 aa

PF13893.13RRM_5229-330 aa

PF00076.29RRM_1250-312 aa

PF22976.3RRM_10351-412 aa

PF00076.29RRM_1360-420 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_035891	`PF13893.13`	RRM_5	5	97	9.9e-43	145.5
LXL04_035891	`PF00076.29`	RRM_1	9	59	3e-30	104.6
LXL04_035891	`PF11835.15`	RRM_8	96	175	3.4e-23	82.4
LXL04_035891	`PF00076.29`	RRM_1	111	165	3e-30	104.6
LXL04_035891	`PF13893.13`	RRM_5	229	330	9.9e-43	145.5
LXL04_035891	`PF00076.29`	RRM_1	250	312	3e-30	104.6
LXL04_035891	`PF22976.3`	RRM_10	351	412	2.7e-08	34.6
LXL04_035891	`PF00076.29`	RRM_1	360	420	3e-30	104.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6ICX4`	Arabidopsis thaliana	Polypyrimidine tract-binding protein homolog 3	83.565%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card