Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1200 bp · TkA04G052570|TK1151|cDNA
ATGGGGGAGAGTGACGCCGAAGTCGTGCAACAGCAAGTATGGAGCAGAGAAACAGTGCCGAAGGTGATGAAGATTATAAGTACCAGACTCCGACTGCCTCAGCGAGACCTCATCTCTCTTCTTCTCGTCTCCTCGTCTCTCCACCGTACTCTCGTTTCCACCGCTTCCCTATGGCTGGTTCTTGATTTTCATGAGATGAATAATGCCGGAGATCGACTTCTAGCTGCCCTTGCGCTGAAGAGATATCATCATGTGAAGCA...
1200 bp · TkA04G052570|TK1151|CDS
ATGGGGGAGAGTGACGCCGAAGTCGTGCAACAGCAAGTATGGAGCAGAGAAACAGTGCCGAAGGTGATGAAGATTATAAGTACCAGACTCCGACTGCCTCAGCGAGACCTCATCTCTCTTCTTCTCGTCTCCTCGTCTCTCCACCGTACTCTCGTTTCCACCGCTTCCCTATGGCTGGTTCTTGATTTTCATGAGATGAATAATGCCGGAGATCGACTTCTAGCTGCCCTTGCGCTGAAGAGATATCATCATGTGAAGCA...
Protein
Download Protein FASTA399 aa · TkA04G052570|TK1151|PROTEIN
MGESDAEVVQQQVWSRETVPKVMKIISTRLRLPQRDLISLLLVSSSLHRTLVSTASLWLVLDFHEMNNAGDRLLAALALKRYHHVKQINLEFAQDIEDKHLDILKNKFAGSLKHLEHLNLNVCQKISDKGIEAITAATSSLKIFSIYWNVRVTDVGISHLVKNCKHIVELNLSGCKGISDKSLQMVGDNYECLELLDITRCIKITDGGLQHIMTKCSGLKSLNLYALSRYQSFISEKDVNAPIKFVCFTDEAYKKLSLLG...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA04G052570 |
|---|---|
| TK1151 ID | TkA04G052570 |
| OH-1004 ID | LXL04_036356 |
| Relationship / confidence | Rbh Below Probable Coverage Or Synteny Threshold / Review |
| Protein identity (%) | 75.800 |
| Protein coverage (%) | TK1151 92.732 / OH-1004 99.282Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA04G052570 | ||||||
|---|---|---|---|---|---|---|---|
| Location | Chr04:14101559-14106335 (-) | ||||||
| Description | Similar to At3g58530: F-box protein At3g58530 | ||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | ||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | ||||||
| GO annotations (OH1004 source) | GO:0006511 ubiquitin-dependent protein catabolic process Biological Process GO:0010506 regulation of autophagy Biological Process GO:0016567 protein ubiquitination Biological Process GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process GO:0044830 host-mediated perturbation of viral RNA genome replication Biological Process GO:0051896 regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction Biological Process GO:0005737 cytoplasm Cellular Component GO:0005886 plasma membrane Cellular Component GO:0016020 membrane Cellular Component GO:0019005 SCF ubiquitin ligase complex Cellular Component GO:0004842 ubiquitin-protein transferase activity Molecular Function GO:0005516 calmodulin binding Molecular Function | ||||||
| KEGG gene cross-reference | ath:AT3G58530 bta:616212 mmu:101358 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF12937F-box-like25-59 aaPF25372LRR_FBXL1535-189 aaPF13516LRR_683-99 aaPF19729LRR_FBXL1884-133 aaPF24758LRR_At5g56370109-149 aaPF12799LRR_4110-128 aaPF29594LRR_SKP2112-176 aaPF13516LRR_6113-134 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA04G052570 | PF12937 | F-box-like | 25 | 59 | 0.064 | 13.8 |
| TkA04G052570 | PF25372 | LRR_FBXL15 | 35 | 189 | 6.5e-20 | 71.7 |
| TkA04G052570 | PF13516 | LRR_6 | 83 | 99 | 1.3e-16 | 59.9 |
| TkA04G052570 | PF19729 | LRR_FBXL18 | 84 | 133 | 0.042 | 13.0 |
| TkA04G052570 | PF24758 | LRR_At5g56370 | 109 | 149 | 0.00014 | 22.3 |
| TkA04G052570 | PF12799 | LRR_4 | 110 | 128 | 2e-10 | 41.3 |
| TkA04G052570 | PF29594 | LRR_SKP2 | 112 | 176 | 1.2e-15 | 58.3 |
| TkA04G052570 | PF13516 | LRR_6 | 113 | 134 | 1.3e-16 | 59.9 |
| TkA04G052570 | PF19729 | LRR_FBXL18 | 131 | 183 | 0.042 | 13.0 |
| TkA04G052570 | PF13516 | LRR_6 | 140 | 158 | 1.3e-16 | 59.9 |
| TkA04G052570 | PF12799 | LRR_4 | 140 | 180 | 2e-10 | 41.3 |
| TkA04G052570 | PF29594 | LRR_SKP2 | 152 | 240 | 1.2e-15 | 58.3 |
| TkA04G052570 | PF13516 | LRR_6 | 163 | 185 | 1.3e-16 | 59.9 |
| TkA04G052570 | PF24758 | LRR_At5g56370 | 163 | 226 | 0.00014 | 22.3 |
| TkA04G052570 | PF13516 | LRR_6 | 192 | 210 | 1.3e-16 | 59.9 |
| TkA04G052570 | PF12799 | LRR_4 | 193 | 224 | 2e-10 | 41.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
| Protein | Organism | Description | Identity | Database | Confidence |
|---|---|---|---|---|---|
Q8LB33 | Arabidopsis thaliana | sp|Q8LB33|FB330_ARATH F-box protein At3g58530 | 41.000% | Swiss-Prot | Medium |