LXL04_036356 | RubberDandelionOmics

Gene overview

LXL04_036356

Reference: OH-1004 Chr: Chr08 Coordinates: 40614745-40616956 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1257 bp · LXL04_036356|LXL04_036356|OH1004|cDNA

ATGGGGGAGAGTGACGCCGAAGTCGTGCAACAGCAAGTATGGAGCAGAGAAACAGTGCCGAAGGTGATGAAGATTATAAGTACCAGACTCCGACTGCCTCAGCGAGACCTCATCTCTCTTCTTCTCGTCTCCTCGTCTCTCCACCGTACTCTCGTTTCCATCGCTTCCCTATGGCTGGTTCTTGATTTTCATGAGATGAATAATGCCGGAGATCGACTTCTAGCTGCCCTTGCGCTGGTttgttccaattccaattccTT...

CDS

Download CDS FASTA

1257 bp · LXL04_036356|LXL04_036356|OH1004|CDS

ATGGGGGAGAGTGACGCCGAAGTCGTGCAACAGCAAGTATGGAGCAGAGAAACAGTGCCGAAGGTGATGAAGATTATAAGTACCAGACTCCGACTGCCTCAGCGAGACCTCATCTCTCTTCTTCTCGTCTCCTCGTCTCTCCACCGTACTCTCGTTTCCATCGCTTCCCTATGGCTGGTTCTTGATTTTCATGAGATGAATAATGCCGGAGATCGACTTCTAGCTGCCCTTGCGCTGGTTTGTTCCAATTCCAATTCCTT...

Protein

Download Protein FASTA

418 aa · LXL04_036356|LXL04_036356|OH1004|PROTEIN

MGESDAEVVQQQVWSRETVPKVMKIISTRLRLPQRDLISLLLVSSSLHRTLVSIASLWLVLDFHEMNNAGDRLLAALALVCSNSNSFSSNSFIFIVTVRVCCLPRGYHYEAMSTKQSLGFQSIEVLLNLYKIQIVVLFFVSQKRYHHVKQINLEFAQDIEDKHLDILKNKFAGSLKHLEHLNLNVCQKISDKGIEAITAATSSLKIFSIYWNVRVTDVGISHLVKNCKHIVELNLSGCKGISDKSLQMVGDNYECLELLD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_036356`
TK1151 ID	TkA04G052570
OH-1004 ID	LXL04_036356
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	75.800
Protein coverage (%)	TK1151 92.732 / OH-1004 99.282 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_036356

Location Chr08:40614745-40616956 (+)

Description Similar to At3g58530: F-box protein At3g58530

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g58530`	F-box protein At3g58530.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036356 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0006511 ubiquitin-dependent protein catabolic process Biological Process

GO:0010506 regulation of autophagy Biological Process

GO:0016567 protein ubiquitination Biological Process

GO:0031146 SCF-dependent proteasomal ubiquitin-dependent protein catabolic process Biological Process

GO:0044830 host-mediated perturbation of viral RNA genome replication Biological Process

GO:0051896 regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0019005 SCF ubiquitin ligase complex Cellular Component

GO:0004842 ubiquitin-protein transferase activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

KEGG gene cross-reference

ath:AT3G58530

bta:616212

mmu:101358

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.586

Rank 1 · LXL04_036356 · OH-1004

Cytoplasm0.286

Rank 2 · LXL04_036356 · OH-1004

Mitochondrion0.072

Rank 3 · LXL04_036356 · OH-1004

Cell membrane0.048

Rank 4 · LXL04_036356 · OH-1004

Endoplasmic reticulum0.032

Rank 5 · LXL04_036356 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25372.2LRR_FBXL15175-297 aa

PF29594.1LRR_SKP2214-264 aa

PF29594.1LRR_SKP2258-407 aa

PF25372.2LRR_FBXL15286-396 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_036356	`PF25372.2`	LRR_FBXL15	175	297	1.8e-17	63.7
LXL04_036356	`PF29594.1`	LRR_SKP2	214	264	5e-18	66.0
LXL04_036356	`PF29594.1`	LRR_SKP2	258	407	5e-18	66.0
LXL04_036356	`PF25372.2`	LRR_FBXL15	286	396	1.8e-17	63.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LB33`	Arabidopsis thaliana	F-box protein At3g58530	62.171%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card