RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA04G022830
Reference: TK1151 Chr: Chr04 Coordinates: 5805792-5811512 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

3114 bp · TkA04G022830|TK1151|cDNA

CCCCACCTTACTCGCAGAGACCCCCTCCCTCTTTTCATCTCCCCTGTTTCTTCTCCAGCTGAAGACTGTCATTACTTCCTCATCTCTCTCTCACACACACAACACGCAAAACCCTTTTTCTTCAATACTCTTCAAGATCTAACAACTGTTTTTTTCTCACTAGATCTCCGTATCTGTATCTATCTCACTCGGTTTCTGTCTGAAACCCGTTTGCATCTGATTTTCGCCGCAGTTTATGGATCTACATTGCGGATTCGAAC...

CDS

Download CDS FASTA

2133 bp · TkA04G022830|TK1151|CDS

ATGTCAATGAGCACAAGATTTCCATCTATATCATCACACACACATCCTTCATATGTACCTGCTTCTTCTCCTTCTCCTTCTCCTTCTCCAACAATTCAAGGCCCTGTTGCTAGCCCTCGAAGAAAGCGACATCGCCATCATTTTCGTCATGGGAAGATCACCCATTCAATCTCTCCATCTCCATCTCCTGTACCAGGTTGTGACCAAACGTGCTCGGAACCACTGACTTCAACTCCACTGGGATCACCATGCGGTTGTGT...

Protein

Download Protein FASTA

710 aa · TkA04G022830|TK1151|PROTEIN

MSMSTRFPSISSHTHPSYVPASSPSPSPSPTIQGPVASPRRKRHRHHFRHGKITHSISPSPSPVPGCDQTCSEPLTSTPLGSPCGCVFPMKVKLLLQVSVYAVFPVVNELEIEIATGTYLTQSQVVITGASADSQNQEKTAVDINLVPLGEKFDNTTALLTYDKIWRKKLSLNRTLFGDYEVVYIIYPGLPSSPPYGGQPGSGPDASPGNRQFPITATFVGKTQKMNPKTIFVITLSAVVLLVVCLAAISVFLKYRKIGR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA04G022830
TK1151 IDTkA04G022830
OH-1004 IDLXL04_036814
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)99.700
Protein coverage (%)TK1151 100.000 / OH-1004 92.708
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA04G022830
LocationChr04:5805792-5811512 (+)
DescriptionSimilar to ALE2: Receptor-like serine/threonine-protein kinase ALE2
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g20300 Required during the differentiation of the protoderm into shoots epidermis and cuticle.
Novel receptor-like kinase ALE2 controls shoot development by specifying epidermis in Arabidopsis.2007 · DOI: 10.1242/dev.003533
At1g68690 Could be involved in the negative regulation of root growth. No verified direct reference in this release
At1g20650 May be involved in plant defense signaling. No verified direct reference in this release
At3g20530 May be involved in plant defense signaling. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os05g0372100 Functions as an immediate downstream signaling partner of CERK1 in the microbial peptidoglycans (PGNs) and fungal chitin signaling pathways that mediate innate immunity.
A receptor-like cytoplasmic kinase targeted by a plant pathogen effector is directly phosphorylated by the chitin receptor and mediates rice immunity.2013 · DOI: 10.1016/j.chom.2013.02.007
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_036814 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0002758 innate immune response-activating signaling pathway Biological Process
GO:0006952 defense response Biological Process
GO:0007165 signal transduction Biological Process
GO:0010068 protoderm histogenesis Biological Process
GO:0030154 cell differentiation Biological Process
GO:0043410 positive regulation of MAPK cascade Biological Process
GO:0045087 innate immune response Biological Process
GO:0045088 regulation of innate immune response Biological Process
GO:0046777 protein autophosphorylation Biological Process
GO:0050832 defense response to fungus Biological Process
GO:0071323 cellular response to chitin Biological Process
GO:0071456 cellular response to hypoxia Biological Process
KEGG gene cross-reference
ath:AT1G68690
ath:AT2G20300
ath:AT3G20530
ath:AT5G18610
dosa:Os05g0372100
osa:4338592
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.817
Rank 1 · TkA04G022830 · TK1151
Cytoplasm0.105
Rank 2 · TkA04G022830 · TK1151
Nucleus0.090
Rank 3 · TkA04G022830 · TK1151
Endoplasmic reticulum0.079
Rank 4 · TkA04G022830 · TK1151
Lysosome / Vacuole0.029
Rank 5 · TkA04G022830 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23180ALE2_N73-191 aa
PF23041DUF703696-178 aa
PF08445FR47261-285 aa
PF00069Pkinase321-591 aa
PF07714PK_Tyr_Ser-Thr323-592 aa
PF03109ABC1324-354 aa
PF01636APH428-467 aa
PF03109ABC1434-474 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA04G022830PF23180ALE2_N731917.6e-55184.9
TkA04G022830PF23041DUF7036961780.1613.3
TkA04G022830PF08445FR472612850.06513.9
TkA04G022830PF00069Pkinase3215914.1e-45155.0
TkA04G022830PF07714PK_Tyr_Ser-Thr3235928.2e-48163.7
TkA04G022830PF03109ABC13243540.02514.5
TkA04G022830PF01636APH4284670.03214.7
TkA04G022830PF03109ABC14344740.02514.5
TkA04G022830PF01636APH5105510.03214.7
TkA04G022830PF08445FR475685930.06513.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8RWW0Arabidopsis thalianasp|Q8RWW0|ALE2_ARATH Receptor-like serine/threonine-protein kinase ALE269.800%Swiss-ProtHigh
Q9SX31Arabidopsis thalianasp|Q9SX31|PERK9_ARATH Proline-rich receptor-like protein kinase PERK955.900%Swiss-ProtLow
Q9LDZ5Arabidopsis thalianasp|Q9LDZ5|PBL21_ARATH Probable serine/threonine-protein kinase PBL2152.700%Swiss-ProtLow
F4JEQ2Arabidopsis thalianasp|F4JEQ2|PBL23_ARATH Probable serine/threonine-protein kinase PBL2352.000%Swiss-ProtLow
Q6I5Q6Oryza sativa subsp. japonicasp|Q6I5Q6|RK185_ORYSJ Receptor-like cytoplasmic kinase 18553.200%Swiss-ProtLow

JBrowse

View in Genome Browser