TkA03G502750 | RubberDandelionOmics

Gene overview

TkA03G502750

Reference: TK1151 Chr: Chr03 Coordinates: 126221273-126227261 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2358 bp · TkA03G502750|TK1151|cDNA

ATGGTTTCGTGTTATGAAATTCGCATACCACAGCCAGAGGCTCTGCCTCTTGGATCCCGGAAGGTGTTGCCACCTCTTGACCCACTGTCAGGGGCATTGCTTCCGAACATCCATGAAGAAGAAGTTTCAAGAATCGTTCCTTTCCAGCTTCAATTCGACAAACCAGTAGCGTCCCAGATCAAAATAGCTGAATGGAACCCAGAGAAAGATTTGCTGGCTATGGTTACCGAAGATTCAAAGATTCTGTTGCATCGGTTCAA...

CDS

Download CDS FASTA

2358 bp · TkA03G502750|TK1151|CDS

ATGGTTTCGTGTTATGAAATTCGCATACCACAGCCAGAGGCTCTGCCTCTTGGATCCCGGAAGGTGTTGCCACCTCTTGACCCACTGTCAGGGGCATTGCTTCCGAACATCCATGAAGAAGAAGTTTCAAGAATCGTTCCTTTCCAGCTTCAATTCGACAAACCAGTAGCGTCCCAGATCAAAATAGCTGAATGGAACCCAGAGAAAGATTTGCTGGCTATGGTTACCGAAGATTCAAAGATTCTGTTGCATCGGTTCAA...

Protein

Download Protein FASTA

785 aa · TkA03G502750|TK1151|PROTEIN

MVSCYEIRIPQPEALPLGSRKVLPPLDPLSGALLPNIHEEEVSRIVPFQLQFDKPVASQIKIAEWNPEKDLLAMVTEDSKILLHRFNWQRLWTISPGRCITSLCWRPDGKAIAIGLQDGTISLHDVENGKLLRSMKSHTVAVVCLNWEDDGGGEISDDKFYTSKYEDRTSRFFPPPPRVPRAPGLVPGESGFMDESENLSQELSNSSHQRFNILCSADKDGIINFSIFGIFPIGKIDIHDFSVTFPIGKEHVDCKLLNAS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA03G502750`
TK1151 ID	TkA03G502750
OH-1004 ID	LXL04_010146
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA03G502750

Location Chr03:126221273-126227261 (+)

Description Similar to APC4: Anaphase-promoting complex subunit 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g21530`	Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin-protein ligase complex that controls progression through mitosis and the G1 phase of the cell cycle.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010146 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007346 regulation of mitotic cell cycle Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0030071 regulation of mitotic metaphase/anaphase transition Biological Process

GO:0031145 anaphase-promoting complex-dependent catabolic process Biological Process

GO:0048481 plant ovule development Biological Process

GO:0051301 cell division Biological Process

GO:0051445 regulation of meiotic cell cycle Biological Process

GO:0070936 protein K48-linked ubiquitination Biological Process

GO:0070979 protein K11-linked ubiquitination Biological Process

GO:0141198 protein branched polyubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT4G21530

ddi:DDB_G0285223

hsa:29945

mmu:52206

pon:100172595

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.537

Rank 1 · TkA03G502750 · TK1151

Nucleus0.363

Rank 2 · TkA03G502750 · TK1151

Golgi apparatus0.113

Rank 3 · TkA03G502750 · TK1151

Endoplasmic reticulum0.088

Rank 4 · TkA03G502750 · TK1151

Lysosome / Vacuole0.070

Rank 5 · TkA03G502750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25171Beta-prop_WDR36-Utp21_1st54-147 aa

PF23414Beta-prop_EML_256-151 aa

PF23775Beta-prop_RIG_2nd56-81 aa

PF23381Beta-prop_IFT122_1st57-173 aa

PF24817WD40_WDHD1_1st57-151 aa

PF23389Beta-prop_WDR19_1st57-151 aa

PF25460Beta-prop_Aladin57-131 aa

PF04762Beta-prop_ELP1_1st57-88 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA03G502750	`PF25171`	Beta-prop_WDR36-Utp21_1st	54	147	5.2e-06	26.8
TkA03G502750	`PF23414`	Beta-prop_EML_2	56	151	1.9e-07	31.5
TkA03G502750	`PF23775`	Beta-prop_RIG_2nd	56	81	0.00026	21.2
TkA03G502750	`PF23381`	Beta-prop_IFT122_1st	57	173	9.7e-13	48.8
TkA03G502750	`PF24817`	WD40_WDHD1_1st	57	151	9.6e-09	35.5
TkA03G502750	`PF23389`	Beta-prop_WDR19_1st	57	151	7.5e-08	32.5
TkA03G502750	`PF25460`	Beta-prop_Aladin	57	131	0.0014	18.5
TkA03G502750	`PF04762`	Beta-prop_ELP1_1st	57	88	0.02	14.5
TkA03G502750	`PF24797`	Beta-prop_WDR35_TULP_N	58	149	6.8e-07	29.5
TkA03G502750	`PF24814`	WD40_Prp19	58	147	1e-06	28.8
TkA03G502750	`PF16755`	Beta-prop_NUP159_NUP214	58	131	0.055	13.4
TkA03G502750	`PF25174`	Beta-prop_THOC3	59	151	7.7e-09	35.7
TkA03G502750	`PF25175`	Beta-prop_WDR5	59	150	3.1e-08	34.0
TkA03G502750	`PF23756`	Beta-prop_HPS5	59	133	0.0035	17.3
TkA03G502750	`PF26550`	Tricorn_2nd	60	151	0.17	11.3
TkA03G502750	`PF24807`	WD40_CDC20-Fz	62	150	5e-11	43.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65418`	Arabidopsis thaliana	sp\|O65418\|APC4_ARATH Anaphase-promoting complex subunit 4	64.900%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card