LXL04_010146 | RubberDandelionOmics

Gene overview

LXL04_010146

Reference: OH-1004 Chr: Chr02 Coordinates: 141042079-141047888 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2535 bp · LXL04_010146|LXL04_010146|OH1004|cDNA

ATGGTTTCGTGTTATGAAATTCGCATACCACAGCCAGAGGCTCTGCCTCTTGGATCCCGGAAGGTGTTGCCACCTCTTGACCCACTGTCAGGGGCATTGCTTCCGAACATCCGTTTTTTCAGGGACTTCTCCCCTAAATGCCAGTTTACGTTTAATCAAAATAAACTAAAACAAATGTGCACTCCGCAATTCATTTTACGTCTACCGCTCCTCATTTGTCAAAGAAAGAAATTAATGTTAGCAATTATTACTTCACTTTA...

CDS

Download CDS FASTA

2535 bp · LXL04_010146|LXL04_010146|OH1004|CDS

ATGGTTTCGTGTTATGAAATTCGCATACCACAGCCAGAGGCTCTGCCTCTTGGATCCCGGAAGGTGTTGCCACCTCTTGACCCACTGTCAGGGGCATTGCTTCCGAACATCCGTTTTTTCAGGGACTTCTCCCCTAAATGCCAGTTTACGTTTAATCAAAATAAACTAAAACAAATGTGCACTCCGCAATTCATTTTACGTCTACCGCTCCTCATTTGTCAAAGAAAGAAATTAATGTTAGCAATTATTACTTCACTTTA...

Protein

Download Protein FASTA

844 aa · LXL04_010146|LXL04_010146|OH1004|PROTEIN

MVSCYEIRIPQPEALPLGSRKVLPPLDPLSGALLPNIRFFRDFSPKCQFTFNQNKLKQMCTPQFILRLPLLICQRKKLMLAIITSLYETYLINMETDEEEVSRIVPFQLQFDKPVASQIKIAEWNPEKDLLAMVTEDSKILLHRFNWQRLWTISPGRCITSLCWRPDGKAIAIGLQDGTISLHDVENGKLLRSMKSHTVAVVCLNWEDDGGGEISDDKFYTSKYEDRTSRFFPPPPRVPRAPGLVPGESGFMDESENLSQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`LXL04_010146`
TK1151 ID	TkA03G502750
OH-1004 ID	LXL04_010146
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.500
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	OH-1004 / GCA_047496595.1_OSU_TarKok_2.0

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · OH-1004

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID LXL04_010146

Location Chr02:141042079-141047888 (+)

Description Similar to APC4: Anaphase-promoting complex subunit 4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g21530`	Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin-protein ligase complex that controls progression through mitosis and the G1 phase of the cell cycle.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010146 · GCA_047496595.1_OSU_TarKok_2.0.

GO annotations (OH1004 source)

GO:0007346 regulation of mitotic cell cycle Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0030071 regulation of mitotic metaphase/anaphase transition Biological Process

GO:0031145 anaphase-promoting complex-dependent catabolic process Biological Process

GO:0048481 plant ovule development Biological Process

GO:0051301 cell division Biological Process

GO:0051445 regulation of meiotic cell cycle Biological Process

GO:0070936 protein K48-linked ubiquitination Biological Process

GO:0070979 protein K11-linked ubiquitination Biological Process

GO:0141198 protein branched polyubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT4G21530

ddi:DDB_G0285223

hsa:29945

mmu:52206

pon:100172595

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.525

Rank 1 · LXL04_010146 · OH-1004

Nucleus0.353

Rank 2 · LXL04_010146 · OH-1004

Golgi apparatus0.114

Rank 3 · LXL04_010146 · OH-1004

Endoplasmic reticulum0.098

Rank 4 · LXL04_010146 · OH-1004

Lysosome / Vacuole0.069

Rank 5 · LXL04_010146 · OH-1004

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF25171.2Beta-prop_WDR36-Utp21_1st113-205 aa

PF24817.2WD40_WDHD1_1st115-210 aa

PF23414.2Beta-prop_EML_2115-210 aa

PF23381.2Beta-prop_IFT122_1st116-232 aa

PF23389.2Beta-prop_WDR19_1st116-210 aa

PF24797.2Beta-prop_WDR35_TULP_N117-208 aa

PF24814.2WD40_Prp19117-206 aa

PF25174.2Beta-prop_THOC3118-210 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
LXL04_010146	`PF25171.2`	Beta-prop_WDR36-Utp21_1st	113	205	5.8e-06	26.6
LXL04_010146	`PF24817.2`	WD40_WDHD1_1st	115	210	6.6e-09	36.1
LXL04_010146	`PF23414.2`	Beta-prop_EML_2	115	210	1.9e-07	31.5
LXL04_010146	`PF23381.2`	Beta-prop_IFT122_1st	116	232	1.1e-12	48.7
LXL04_010146	`PF23389.2`	Beta-prop_WDR19_1st	116	210	9.3e-08	32.2
LXL04_010146	`PF24797.2`	Beta-prop_WDR35_TULP_N	117	208	7e-07	29.4
LXL04_010146	`PF24814.2`	WD40_Prp19	117	206	1.1e-06	28.7
LXL04_010146	`PF25174.2`	Beta-prop_THOC3	118	210	7.8e-09	35.7
LXL04_010146	`PF25175.2`	Beta-prop_WDR5	118	209	3.5e-08	33.8
LXL04_010146	`PF24807.2`	WD40_CDC20-Fz	121	209	3.1e-11	43.8
LXL04_010146	`PF12894.14`	ANAPC4_WD40	123	208	1.2e-29	103.1
LXL04_010146	`PF25173.2`	Beta-prop_WDR3_1st	158	210	7.6e-08	33.0
LXL04_010146	`PF12896.13`	ANAPC4	351	553	7.5e-59	199.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O65418`	Arabidopsis thaliana	Anaphase-promoting complex subunit 4	64.714%	Swiss-Prot	strong database homology

JBrowse

View in Genome Browser

Gene Card